I sequence the DNA of 3 people and see variation in my gene of interest as follows: Person 1: ATGCAACAATTTAATAAT Person 2: ATGCAACGACGACGACGACAATTTAATAAT Person 3: ATGCAACGACGACGACGACGACGACGACGACAATTTAATAAT What is the name for this kind of variation?
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
I sequence the DNA of 3 people and see variation in my gene of interest as follows:
Person 1: ATGCAACAATTTAATAAT
Person 2: ATGCAACGACGACGACGACAATTTAATAAT
Person 3: ATGCAACGACGACGACGACGACGACGACGACAATTTAATAAT
What is the name for this kind of variation?

DNA sequence variations among members of a population are referred to as genetic variation. Germ cells as well as somatic cells are subject to variation.
Step by step
Solved in 2 steps









