3. Look at the sequences below. If you add a restriction enzyme(that cuts at GAATTC) to the uncut DNA, how many DNA fragments will result? Circle the fragments. Uncut DNA 1: TGATCGTGGAATTCGATGATCGAATTCGCTAGCTGAATTCAAAAAA ACTAGCACCTTAAGCTACTAGCTTAAGCGATCGACTTAAGTTTTTT Number of fragments: Uncut DNA 2: Number of fragments: TGATCGTGGACTTCGATGATCGAATTCGCTAGCTGAATTCAAAAAA ACTAGCACCTGAAGCTACTAGCTTAAGCGATCGACTTAAGTTTTTT Uncut DNA 3: Length of fragments: Number of fragments: Length of fragments: basepairs (ignore ends with unpaired bases) TGATCGTGGACTTCGATGATCGAATTCGCTAGCTGCATTCAAAAAA ACTAGCACCTGAAGCTACTAGCTTAAGCGATCGACGTAAGTTTTTT Length of fragments: basepairs (ignore ends with unpaired bases) basepairs (ignore ends with unpaired bases)

Q: Using the same template strand, transcribe the DNA: GCA TAG CAA TGC

A: Answer: Transcription : It is the process of transcribing DNA to RNA using the template strand of…

Q: Directions: Transcribe the following strand into mRNA, then translate it into amino acids Example…

A: We'll see into one particular occurrence of this procedure here. A DNA sequence will be the…

Q: Take each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication…

A: A set of guidelines known as the genetic code controls how genetic information is converted from DNA…

Q: Check the new protein created by your new DNA. Describe how this changed the protein (amino acid…

A: Deoxyribonucleic acid is a molecule made out of two polynucleotide chains that curl around one…

Q: You are a scientist studying the function of a gene you find interesting. You need to produce…

A: The synthesis of proteins is essential to biological processes and has numerous applications in…

Q: DNA duplication TAT GCA CTA ATA TAT GCA [triplets] ____ ____ ____ ____ _____ ____ Protein synthesis,…

A: The process of duplicating or replicating the given template stand DNA is called replication. Next…

Q: A cloned fragment of DNA was sequenced by using the dideoxy method. A part of the autoradiogram of…

A: Sanger sequencing, often called chain-termination sequencing, is a DNA sequencing technology…

Q: 1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Restriction enzyme:   Recognition sequence:     Number of pieces of DNA:  Type of cut:

A: In the question a DNA sequence is given with its nucleotides.  Restriction enzyme is an enzyme that…

Q: Fill in the blank spaces below with the most appropriate terms. The word bank is not provided. DNA…

A: During cell division DNA makes a copy of itself and this process is called DNA replication. In this…

Q: Once you have cut your circular DNA it becomes linear and you need to insert/glue the functional…

A: Recombinant DNA technology It is a technique that alters the phenotype of an entity(host) when a…

Q: iginal mplate) HA denine Thymine Cytosine Guanine nzymes and structures to label: hromosome…

A: A chromosome is a long DNA molecule with part or all of the genetic material of an organism.Most…

Q: 30.Match the definition with one of the choices on the right (can be used more than once) Place with…

A: DNA or deoxyribonucleic acid is the main molecule that is responsible for the purpose of storing…

Q: Check the new protein created by your new DNA. Describe how this changed the protein (amino acid…

A: Any change in the DNA is called mutation. Some Mutations are beneficial because they add on the…

Q: Below is another template DNA sequence, and you want to use PCR to amplify the region in bold. What…

A: PCR is polymerase Chain Reaction, a technique used in biotechnology  to amplify the selected DNA…

Q: I need help with a microbiology question from my study guide. The question involves DNA sequencing.…

A: mRNA sequence transcribed from the given template (antisense) is:   3'-A U G A C U G A C U G C U A G…

Q: Below is a template strand (top) being replicated by DNA polymerase.   The black arrow is pointing…

A: DNA is the genetic material of almost all living organisms. It contains the information that is…

Q: A frameshift mutation occurs in a DNA strand. The mutation is a deletion of the two nucleotides…

A: A frameshift mutation is a genetic mutation caused by a deletion or insertion in a DNA sequence that…

Q: Drag an arrow in the appropriate direction of travel for DNA Helicase Replication fork Trihoshate…

A: The course of replication is done with the assistance of various enzymes, for example, helicase, DNA…

Q: 25. The restriction enzymes Kpnl and Acc65l recognize and cleave the same 6-bp sequence. You have a…

A: Restriction enzymes are the DNA digesting enzymes.

Q: You amplify the DNA sample shown with the indicated primers. Highlight in yellow the region that…

A:

Q: Shown is a sequencing gel. Read the sequence off the gel and determine the first 4 nucleotides (or…

A: Deoxyribonucleic acid (DNA) is a molecule that contains the genetic instructions for the…

Q: Rank from the first to the last steps in DNA synthesis. Reset H DNA polymerase DNA strands separate…

A: The process by which a DNA molecule makes its own identical copy e is called as DNA replication . It…

Q: You have the following DNA sequence: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and…

A: “Since you have posted multiple questions, we will provide the solution only to the first question…

Q: In the boxes below, complete the Original DNA, DNA Copy and/or RNA

A: DNA replication is the process in which one of the strands of DNA is used as a template and a new…

Q: Use the chart to determine the correct amino acid that this DNA would 1 point code for - ATA

A: Introduction:-  In order to determine the gene sequence based off an mRNA template. We can simply…

Q: In a Sanger sequencing-based PCR reaction, which molecules are more common:

A: The most important techniques available to the molecular biologist is the DNA sequencing by…

Q: please answer i'll give thumbs up

A: The DNA sequence is read from the bottom of the gel to the top, including bands in all four lanes.…

Q: 8. You perform a PCR experiment using the template and primers shown below. What size is the…

A: PCR stands for Polymerase Chain Reaction. It is a laboratory technique used to amplify a single or a…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.