2a. The DNA is mutated on the 4th base pair to the following: DNA:3'TAC GAT GAG GTC TGA ACT 5' 5 ATG CТА СТС САGАСТ TGA 3 2b. Does this mutation change the amino acid sequence? (Yes or No) If yes – what is new amino acid sequence? Protein:

Q: 1. A point mutation occured at base 6 in the original DNA, provide the amino acid seuence and the…

A: Any detectable, inheritable qualitative or quantitative changes in genetic material of an organism…

Q: II. Give the translation of the segment of a polypeptide chain below. Specify your template strand.…

A: The template strand is a DNA strand that functions as a template for the synthesis of complementary…

Q: Fill in the table. Nucleic Acid Comparison DNA ml

A: Nucleic acid- It is an macromolecule found in all type of cell. In other word you can says that…

Q: uisCUntinuous 4. The sequence of base triplets on the coding strand of part DNA molecule is…

A: tRNA is a RNA molecule that helps in protein synthesis. tRNA forms base pair with complementary…

Q: . Refer to the protein phe-trp-tyr-cys-ala-met-leu, construct a DNA strand that can transcript an…

A: The central dogma of molecular biology describes the flow of genetic information in the cell from…

Q: One section of lactoferrin contains the amino acid sequence shown below.   Arginine – Serine –…

A: Codon - It is a series of 3 nucleotides that code for specific amino acid in the process of protein…

Q: I. Chaperonins serve as sites for proper folding of partially translated polypeptides. II.…

A: Chaperones are the protein that is required to guide the proper folding of the proteins so that the…

Q: ws the standard (coding strand) DNA amino acids involved in protein synthesi plate strand is shown…

A: DNA replication is a process in which DNA itself form DNA . It is two stranded , ladder like and…

Q: 4. Compare the DNA sequences of individuals with Alzheimer's disease and their family members. Two…

A: The amyloid beta precursor protein (APP) is coded by the APP gene that is located on the chromosome…

Q: What is the name of the DNA strand which copies the MRNA?

A: The DNA is genetic material in living organisms that is made up of two antiparallel polynucleotide…

Q: C. Two mutations are known in the population, one shaded in yellow and one in blue, in the TEMPLATE…

A:

Q: 2. Refer to the protein phe-trp-tyr-cys-ala-met-leu, construct a DNA strand that can transcript an…

A: mRNA stands for messenger RNA which is a single stranded RNA molecule that is complementary to one…

Q: sequence of amino acids.

A: The central dogma of molecular biology is the concept which explains the flow of genetic…

Q: 2. Provide the sequences of the template and coding strands of a DNA double helix that was used to…

A: The RNA or ribonucleic acid is produced from the DNA by the transcription process. RNA is used for…

Q: How has the mutation altered the polypeptide? Is the function of the hemoglobin molecule (which…

A: Sickle cell disease is a blood disorder characterized by sickle shaped RBCs which has got less…

Q: 1. Write the complementary base sequence for the matching strand in the following DNA section:…

A: Introduction: Complementarity is the fundamental concept of DNA replication and transcription since…

Q: How many codons are there in the mutated DNA - (b) and DNA - (c)?

A: DNA is the store house of genetic information. This genetic information expressed by the formation…

Q: 2. DNA Template:  TTA - CAT - CAT - ATC - GAT - GAC  mrNA: tRNA: Amino acid sequence:

A: All cells divide to give rise to new cells at some specific stage of their life or throughout. The…

Q: a. Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1…

A: Transcription is a process in which a DNA strand is transcribed into mRNA by an RNA polymerase…

Q: I. List the sequences of RNA that would be transcribed from the following DNA template sequences. а.…

A: Transcription is the initial stage in gene expression, when genetic information is utilised to build…

Q: What is the Complimentary DNA Strand to CGTCAGCAGACGAAAGGGCTTGCGGCGCGC. What is the content of CG in…

A: To find the complementary DNA (cDNA) strand, we need to identify the base pairs for each nucleotide…

Q: 19) Thalassaemia is a genetic disorder in which the red blood cells in the body cannot carry oxygen.…

A: Given: Thalassaemia is a genetic disorder in which the red blood cells in the body cannot carry…

Q: 3. Below is part of the DNA genetic code for six amino acids. TTT AAA Codes for phenylalanine САА…

A:

Q: A particular DNA coding segment is ACGTTAGCCCCAGCT. Write the sequence of nucleotides in the…

A: DNA is the genetic material present in our body and RNA encodes for protein molecules. DNA and RNA…

Q: Which of the following statement about the DNA double helix is correct А. Sugar-phosphate backbone…

A: DNA is composed of nucleotides attached together via phosphodiester bonds. DNA is known as…

Q: 3. How many amino acids are there in the polypeptide (protein)?

A: Introduction :- Amino acids are molecules that join together to form proteins. The building blocks…

Q: 8. A single nucleotide polymorphism changes one nucleotide in a gene sequence. The gene 300 bp size…

A: INTRODUCTION Single nucleotide polymorphism Here in a DNA sequence there is an alteration in the…

Q: 32. What are the two components of tRNA which are important for building a protein? what are…

A: The tRNA is responsible for transferring amino acids to the ribosome at the site of translation.…

Q: ing the following DNA sequence determine the amino acid sequence: AGAGGTCCGCGTTTAGACAT5' et Val Ser…

A: Complementary strand of RNA is formed by complementary base pairing that occurs between adenine and…

Q: D. Fill in the table below. Determine the correct template and coding strands to properly answer…

A: DNA is a double helical macromolecule that has genes that contain the necessary information for the…

Q: Describe the relationship between chromosomes, cells, and DNA 2. [Use Pictures]        - How does…

A: The genetic information necessary for an organism to develop and operate is carried by the molecule…

Q: Which structure is responsible for translating MRNA? O a. RNA Polymerase II O b. RNA polymerase I O…

A: Introduction Messenger ribonucleic acid (mRNA) is a single-stranded RNA molecule that corresponds to…

Q: Please choose the correct answer. Given the sense strand of DNA, A T G T A A C C G C G C A A G G G C…

A: Transcription is the process in which RNA is made from DNA. Translation is the process of making…

Q: 1. In the DNA sequence, the bottom strand is a template strand. If the base pair G-C (in bold) is…

A: Transcription is a process which involves formation of RNA molecules from DNA. One of the DNA strand…

Q: Write the sequences of bases in the sense strand of DNA that resulted in the mRNA in Problem .

A: DNA is a double helical molecule, in which two complementary strands are held together with the help…

Q: Shown below is a nucleotide sequence alignment consisting of corresponding sequences of the same…

A: A change in the normal specific DNA sequence that can arise due to the anomaly is DNA replication or…

Q: a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS…

A: DNA replication is a phenomenon in which DNA make itself using Enzyme DNA Polymerase . It occurs in…

Q: where intercalating agents are found   demethylated methylated.

A: CpG stands for 5'—C—phosphate—G—3', which means that cytosine and guanine are separated by just one…

Q: N- NH O=P-OCH, `NH, HN он 'N. O= P- OCH, NH, ОН 'N N. O= P-OCH, OH ОН

A: There are mainly two types of nucleic acids:- deoxyribonucleic acid (DNA) and ribonucleic acid…

Q: C. Two mutations are known in the population, one shaded in yellow and one in blue, in the TEMPLATE…

A: Mutations are changes in the sequence of DNA that arise due to a change of nucleotides, which can be…

Q: Water can dissolve many substances including some big molecules such as proteins because of its…

A: Water is a transparent, odorless, tasteless, inorganic chemical substance. It is composed of…

Q: 6. Use the image to determine what type of mutation is found in each of the DNA strands below and…

A: The provided data showcases different mutations in DNA strands and their corresponding effects on…

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.