2. The following figure represents the primary transcript of a typical eukaryotic protein-coding gene: Polyadenylation site Exon 1 Intron 1 Exon 2 Intron 2 Exon 3 bp: 1 50 600 945 1205 1393 1725 What is the size in bases of the fully processed, mature mRNA? Assume a poly (A) tail of 200 adenine а. residues in your calculations. b. This primary transcript is responsible for the production of a 294 amino acid protein in the liver and a 270 amino acid protein in the brain. Explain how this is possible.

Q: What would be the 5 first nucleotides that form the mRNA?

A: Transcription is an important step in the gene expression in eukaryotes and Prokaryotes. It involves…

Q: 2. The following figure represents the primary transcript of a typical eukaryotic protein-coding…

A: Eukaryotic protein-coding genes are segments of DNA in eukaryotic organisms that contain…

Q: What is self-splicing intron? Cite two reasons that suggest cukaryotic spliceosomes originated from…

A: RNA (ribonucleic acid) is the complementary strand of DNA (deoxyribonucleic acid) which is…

Q: The following DNA nucleotides are found near the end of a bacterial transcription unit.…

A: The functions of DNA and RNA are controlled by genes. Genes are made up of a distinct collection of…

Q: ALTE

A: Exon is a genetic code region that contains the information needed to enter a protein code. In…

Q: 2. Given a DNA template molecule of 5'- ATGGCTCCTACCTACTAGTTAACATATGG-3', generate the mRNA sequence…

A: We are given a sequence of DNA in 5'-3' direction.  We have to generate the mRNA sequence and then a…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: کو اتار کر کے TATAAA box Translation initiation codon Intron 1 Exon 2 Intron 2 A. 5' Capping defect…

A: The answer is option           The answer is option (E). Protein truncation.

Q: . The human gene for ß2 lens crystallin has the components listed below. The numbers represent…

A: Since we only answer up to 3 sub-parts, we’ll answer the first three. Please resubmit the question…

Q: b. You have found two mutant alleles of Gene A that have insertion of the three base pairs (as shown…

A: DNA is the deoxyribonucleic acid. It is a double-stranded molecule, which consists of two strands:…

Q: 20. in differential translation, a different transcript may be recovered depending on which TATA box…

A: Translation: The process through which RNA codes for specific proteins is known as translation. It…

Q: A mutation in the Duchenne muscular dystrophy gene involves the deletion of two bases and their…

A: Boys are mostly affected by the Duchenne muscular dystrophy (DMD). It's an X-linked recessive…

Q: 1. Describe at least four ways in which transcription is different from DNA replication.

A: As per our company's guidelines we are supposed to answer a single question at a time only. Please…

Q: #7

A: There are different types of mutations, that result in a change or no change in the protein…

Q: LIOCTOTmats Provide the three-letter amino acid sequence expected from each of the following mRNA…

A: Question - 1- Provide the three-letter amino acid sequence expected from each of the following mRNA…

Q: mRNA maturation in eukaryotes includes all of the following EXCEPT: A. Topoisomerase activity B.…

A: In eukaryotic cells, the primary transcript undergoes post transcriptional modification to form a…

Q: 7. A molecule of mRNA from bacteria is shown below: 5'- GUUUCCGAGGAGGCGUAUACAUGUCAGUGGGGGC... -3'…

A: Protein synthesis or translation is the final step of gene expression. This process is divided into…

Q: What is the total size of the mature i.e. fully processed mRNA in nucleotides?

A: Primary transcript of mRNA contains exons as well as introns.  But After the process of splicing…

Q: 5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU…

A: mRNA is made from DNA by the process of Transcription.

Q: Match the function with the appropriate protein or sequence:

A: tRNA is a short nucleotide chain with L-shaped structure. A tRNA molecule is required for…

Q: . (a) Which codon is the start codon in the mRNA below? mRNA 5 - AAUAUGCGGAUGCCCGAA -3     AAU…

A: Ans - a.)  AUG is the start codon in the mRNA 5 - AAUAUGCGGAUGCCCGAA -3. # AUG acts as initiator…

Q: Although the RBS (Ribosome-Binding Site) sequences vary considerably in different genes, they…

A: A ribosome binding site (RBS) is a sequence of nucleotides located upstream of the start codon of an…

Q: How would the following affect BOTH transcription and translation of a particular multi- exon gene…

A: Transcription and translation are two distinct processes that allow the expression of a gene.…

Q: Examine the following mRNA transcripts: Wild type: 5' CACUGAUGCACGGAUCAU 3' Mutant: 5'…

A: Mutation is in 3rd codon from 3' end. In wild type it codes for histidine while in mutant it codes…

Q: The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains…

A: The AUC and AUA codons in mRNA both specify isoleucine. This feauture of the genetic code explains…

Q: 2. Several techniques were used to study the degree of translocation of truncated intermediates in…

A: Here translocation is defined as synthesis of protein by ribosome-tRNA complex as it moves on mRNA…

Q: 293T-Splicing Reporter - Spliced Relative Band Intensity 60 55- ** *** ······· 1: :: HeLa-Splicing…

A: The following information discusses the relationship between Splice Reporter mRNA and Relative Band…

Q: start with four exons and show mutually exclusive splicing producing 1-2-4 and 1-3-4 spliced exons.…

A: Mutually exclusive splicing is a phenomenon in which different exons are alternatively spliced,…

Q: Which mRNA modification is likely absent if the mRNA is degrading prematurely from the 5’ end of the…

A:

Q: Part of a gene is written below, and transcription begins at the boxed T/A base pair and proceeds…

A: Gene is present on a chromosome and contains hereditary information. These genes are later…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: In the given segment 3 ’ C A G T T A C G G C T C C T A G G T T A T A A T T C G T T T C  5 ’…

A: DNA replication occurs with the help of several enzymes and is always synthesized in 5' to 3'…

Q: C a 3' 5' exon intron exon intron exon intron untranslated region (UTR) coding sequence (CDS) Label…

A: Genes are the hereditary unit of an organism. It is inherited by the progeny from the parental…

Q: b) How does accuracy of aminoacylation during tRNA charging regulated to ensure fidelity of genetic…

A: Answer. The fidelity of protein synthesis depends on the accuracy of the two mechanisms: The linking…

Q: Imagine that you repeat the tRNA Selection experiment with modifications as follows: 1. Synthesize…

A: We know that the amino acid sequence of a polypeptide synthesized with respect to an mRNA is based…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.