Procedure:Refer to the Genetic Code Table below to identify the right amino acid coded.To determine the order of bases in the first column (uNA), second column (codon) and the third columnis the anticodon. Consider the complementary base pair in DNA and in RNATo identify the amino acid, took at the bases in the MRNA codon, example AUG using the Genetic CodeTable. Lool: for the first letter of the MRNA codon on the left side of the genstic code table (A), thesecond letter of the MRNA on the second letter column (U), and the third letter on the right-side column(G). AUG codes for the amino acid -methionine, Do the same with the other codons in the chart.Genetic Code Table2nd posttion of codonUUU PhePhenylalanine UCU Ser S SerinePhenylalanine UC C Ser S SerineUCA Ser S SerineUCe Ser S SerineCCU Pra P ProlineUAU Tyr Y TyrosineUAC Tyr Y TyrosineUGU Cys C ysteineUGC Cys C CysteineUUC Phe FUUA LauUUG LeuCUU LeuCUCCUALeucineUGAUGG Trp W Tryptophan GstopstopLLeucineLeucineLAGCAU His H HistidineCAC Hs H HistidineCAA Gin Q GlutaineCAG Gin Q Glutaminestopcau Arg R Argininecac Arg R ArginineCGA Arg R ArginineArgin neLeuLeucineCCCPro P ProlineCCA Pro P ProlinecCG Pro ProlineACU Thr T Threonine AAU Asn N AsparagineAGU Ser sACC Thr T Threor in AC Asn II Asperagine AGC SerSACA Thr T Threonine AAA Lys K LyaineACG Thr T Threonine AAG Lys K LysineGcu Ala A AlanineGGG AlaA AlanineGCA Ala A AlanineGCG Ala A AlanineLeuLeucineCUG LeuAUU IleLeucineIsoleucineCGG ArgRSerineAUC ileIsoletucineAUA leAUG Met M MethionineGUU ValGUC ValGUA ValGUG ValSerineAGA Arg R ArginineAGG Arg K ArginineGGU Gly G alycineGGC Gly G GlycineGAA Glu E Glutamate GGA Gly G GlycineGAG Glu E Glutamate GaG Gly G GlycineIsoleucineGAU Asp D AspartateGAC Asp D AspartateValineVarinev Valinev Veline1. Why is specific.base pairing essential to the process of transcription and translation?2.How many codons codes for one amino acid?Ist postion of codon)ard postion of coden (3) Order of bases in DNAOrder of bases in MRNA(codor)AUCOrder of bases in tRNAAmino acid coded into(anticodon)UAGTAGproteinsCATCAUGUCCCAATGMethionine (Met)Vallne (Val)GUU, GUC, GUA, GUGACUACAUGUAAAAAAGAACUUProcedure:

Name: Procedure:Refer to the Genetic Code Table below to identify the right
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Procedure:Refer to the Genetic Code Table below to identify the right amino acid coded.To determine the order of bases in the first column (uNA), second column (codon) and the third columnis the anticodon. Consider the complementary base pair in DNA