1 kb B1 kb E 6 kb Gene X E1 kb B 5 kb. Gene Z Ечко! B 1 kb ← The figure above shows a linear chroínosome containing Gene X and Gene Z and the location of sites for the restriction enzymes EcoRI (E) and BamHI (B). Refer to this map as you answer the question below. If you digest this DNA with EcoRI, then perform agarose gel electrophoresis, how many bands, and what sizes, would you expect to see? a) Two bands on the gel corresponding to the sizes 2 kb and 6 kb b) Three bands on the gel corresponding to the sizes 1 kb, 6 kb and 8 kb. c) Three bands on the gel corresponding to the sizes 1 kb, 5 kb and 6 kb d) Four bands on the gel corresponding to the sizes 1 kb, 2 kb, 5 kb and 6 kb e) Four bands on the gel corresponding to the sizes 2 kb, 3 kb, 4 kb and 8 kb

Q: A. A plasmid is shown with the locations of various restriction enzyme sites labeled. If you cut the…

A: if we cut the plasmid with XhoI and XbaI then we will get three fragments of following sizes  1000…

Q: On the gel shown below are four DNA samples. Samples A to C are taken from tissues of landslide…

A: The gel electrophoresis is used to separate the DNA fragments according to their sizes. The smaller…

Q: Describe the banding pattern seen in the gel. What does that tell you about the role of annealing…

A: Gel electrophoresis is a laboratory technique for separating charged molecules such as DNA, RNA, and…

Q: The red line indicates where a radioactively labeled probe hybridizes. Three samples of the genomic…

A: P                      B                         PB…

Q: Restriction endonuclease digestion of a DNA sequence yielded fragments of the following sizes: 1.…

A: The objective of the question is to determine the order of DNA fragments after gel electrophoresis…

Q: A virus with a circular double-stranded DNA chromosome contains approximately 10,000 bp. You want to…

A: To construct a map of the viral chromosome based on the cleavage sites of the restriction…

Q: You plan to clone exon 11 of the HEXA gene (Section C) into the multiple cloning site (MCS) of the…

A: Answer well explained above

Q: This is a restriction map for the 250 base pair plasmid pSage. Restriction sites for the restriction…

A: Restrictions endonucleases are enzymes that cut down the DNA into fragments near or at the site of…

Q: A new restriction enzyme is discovered. It recognizes a 6 base pair pallindromic sequence. The first…

A: BASIC INFORMATION  RESTRICTION ENZYME  they are also known as molecular scissors it was in the year…

Q: 1a) E. coli DNA and binturong DNA are both 50% G-C. If you randomly shear E. coli DNA into 1000 bp…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via a…

Q: please solve this step by step with clear explaination

A: To convert the given amounts of DNA from micrograms (μg) to microliters (μl), we need to use the…

Q: They have purified a 1100 bp HindIII restriction fragment that they plan to sequence. As a first…

A: EcoR1:  EcoR1 is a restriction endonuclease enzyme found in the E. coli bacteria. It's a restriction…

Q: When using the plasmid shown below for cloning, which restriction enzyme site(s) (all indicated with…

A: A plasmid is a double-stranded DNA molecule that is small and circular in shape.  Bactria and yeast…

Q: Which of the following would allow for control of a gene's orientation when inserted into a plasmid…

A: The technique of molecular biology used to generate similar copies of a particular segment (gene) of…

Q: Restriction enzymes come in a concentration of U/ml, and it is recommended that 1U be used for each…

A: Restriction enzymes (RE) are the enzymes that recognize and cut specific sequences of DNA called…

Q: Decide on two restriction sites that you can use to clone this into pL4440’s MCS. Identify their…

A: DNA cloning restriction sites are specific DNA sequences recognized and cleaved by restriction…

Q: How many DNA fragments will result when the double-stranded DNA molecule below is digested with…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: The sequence 5' GCCTAATGCGTTCATAATGGCGTTTGCCACGGACGTAAAGTCGT 3' represents 50% of a PCR product…

A: Agarose gel electrophoresis used to separate DNA according to its molecular weight. On agarose gel,…

Q: How would you expect your results to change if the enzyme did not have time to cut all of the sites?…

A: The resultant DNA fragments would have different sizes if the enzyme did not have enough time to cut…

Q: between the two restriction sites, how would the banding pattern on the gel differ from the one you…

A: Restriction sites are the special palindromic sequences present in DNA. These sites are the location…

Q: Primers designing for epitope tagging: Design forward and reverse primers to amplify the following…

A: Primers should generally have the following properties: 1. Length of 18-24 bases. 2. 40-60% G/C…

Q: DNA samples from four individuals were cleaved with the same MW restriction endonuclease. The DNA…

A: Any human biological specimen taken or preserved for the purpose of extracting and analysing DNA in…

Q: Given the DNA sequence of the restriction enzyme: gi|6329444|dbj|AB034757.1| Hynobius retardatus…

A: Restriction enzyme is a protein isolated from bacteria that cleaves DNA sequences at sequence…

Q: You have another circular plasmid. Complete and effective digestion of this plasmid with a…

A: The restriction enzymes are endonuclease that means they can cut the DNA from the middle. They are…

Q: You are studying a genome that has 42% G:C content and the remaining 58% of the genome is As and Ts.…

A: Restriction enzymes  The enzyme that is use to cut the DNA at specific site.

Q: In order to simplify your analysis, rather than including an actual DNA sequence, I have simply…

A: IntroductionThe data provided describes the potential inserts that can be generated using HindIII…

Bacterial Genomics

The study of the morphological, physiological, and evolutionary aspects of the bacterial genome is referred to as bacterial genomics. This subdisciplinary field aids in understanding how genes are assembled into genomes. Further, bacterial or microbial genomics has helped researchers in understanding the pathogenicity of bacteria and other microbes.

Transformation Experiment in Bacteria

In the discovery of genetic material, the experiment conducted by Frederick Griffith on Streptococcus pneumonia proved to be a stepping stone.

Plasmids and Vectors

The DNA molecule that exists in a circular shape and is smaller in size which is capable of its replication is called Plasmids. In other words, it is called extra-chromosomal plasmid DNA. Vectors are the molecule which is capable of carrying genetic material which can be transferred into another cell and further carry out replication and expression. Plasmids can act as vectors.