1) Given an mRNA with the following sequence, please translate the codons to a chain of amino acids. Use the codon chart below.5’AUG/CCU/GCU/UAC/CGG/GAG/UAA3’ “met-_________-_________-_________-_________-_________”STOP” 2) Assuming the original polypeptide chain below, match each type of point mutation with the polypeptide chain that results. Original polypeptide: Pro-Thr-Ser-Leu-Leu-His-Asn A. Missense B. Silent C. Nonsense D. Frameshift ______ Pro-Thr-Ser-STOP ______ Pro-Thr-Ser-Leu-Ile-His-Asn ______ Pro-Thr-Ser-Leu-Leu-His-Asn _______ Pro-Thr-His-Cys-Tyr-Thr

1) Given an mRNA with the following sequence, please translate the codons to a chain of amino acids. Use the codon chart below.5’AUG/CCU/GCU/UAC/CGG/GAG/UAA3’ “met-_____-_-_-_-_”STOP” 2) Assuming the original polypeptide chain below, match each type of point mutation with the polypeptide chain that results. Original polypeptide: Pro-Thr-Ser-Leu-Leu-His-Asn A. Missense B. Silent C. Nonsense D. Frameshift Pro-Thr-Ser-STOP Pro-Thr-Ser-Leu-Ile-His-Asn Pro-Thr-Ser-Leu-Leu-His-Asn _____ Pro-Thr-His-Cys-Tyr-Thr

Name: 1) Given an mRNA with the following sequence, please translate the cod
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 1) Given an mRNA with the following sequence, please translate the codons to a chain of amino acids. Use the codon chart below.5’AUG/CCU/GCU/UAC/CGG/GAG/UAA3’“met-_________-_________-_________-_________-_________”STOP” 2) Assuming the original polype

3-2-1 Code It

6th Edition

ISBN:9781337660549

Author:GREEN

Publisher:GREEN

Chapter2: Introduction To Icd-10-cm And Icd-10-pcs Coding

Section: Chapter Questions

Problem 3MC

See similar textbooks

Similar questions

write a correct terminology/word on column B that meet the description of column A COLUMN A COLUMN B 1. The site for protein synthesis where mRNA and tRNA meets. 2. Benign tumours or warts that might cause problems but do not spread to oyher parts of the body. 3. A nucleotide sequence that is complimentary to the mRNA codon. 4. A condition that depicts injury or diseased state of liver. 5. Term used to describe a process or condition which affects the general body function. 6. A type of virus that attacks the respiratory system to cause flue 7. The fluid found within the cell 8. A condition which describes harm, damage or impairment of kidney function. 9. To spilt a molecule or chemical bond. 10. The protein coat or shell of a virus
The line below represents a mature eukaryotic mRNA. The accompanying list contains many sequences or structures that may or may not be a part of mature eukaryotic mRNA. As accurately as you can, show the location, on the line, of the sequences or structures that belong on the eukaryotic mRNA; then separately list the items that are not part of eukaryotic mature mRNA. 5’____________________________________________________3’ A-stop codon B-poly-A tail C- intron D- 3’UTR E-promoter F- start codon G- AAUAAA H- 5’ UTR I- 5’ cap J- Termination sequence
Kindly check if the answer is correct if not write the correct answer.
Please answer all the questions as soon as possible
TAC/ACC/GAC/GAA/AAT/TGT/TAC/CGT/TCA/AAC asap please
Draw the peptide at a pH @1 of Cys-His-Glu-Met-Ile-Ser-Thr-Arg-Tyr - do it on this format
Kindly help, I don't understand this topic :(( In each of the following DNA sequences, write the contesponding mRNA transcript right beside the item we the item and use the genetic code to determine the resulting amino acid sequence. You may proceed even without the start codon 1. TTTTACCATCCCACAATTTA 2 ACTACTTTCAGAGCTATATTCAG 3. CATTACGGAGCCTGATGCACTTAC 4. TACGCCGCAACTCCGTATGGO 5. Garg-CTACAGCCCTAGCATTTACCCG
In the text box below, answer the following questions. Remember to label your answers that correspond to the questions, and attempt answering all of the questions to receive full credit. 1. Use the table of the genetic code to complete the following table. The columns represent transcriptional and translational alignments. Label the 5' and 3' ends of DNA and RNA, as well as the amino (N) and carboxyl (C) ends of the protein. end end DNA double G A helix 3' CA U MRNA transcribed G C A TRNA anticodon Trp Amino acid
Translate the following mRNA. Use the space for your answer. 5’GAGGCCGACGUGCCGACGUCAGAUGGCUAAAGAAAUGUAUGACGCUUAUGGUGAAACUGCUAAUGCCUAGCCAAAGGCUCCUUUUGGAGCUUUUUUUU 3’
"Kindly answer this and make an explanation. That will be my reviewer."
Write down the corresponding amino acids sequence for each mRNA sequence. Use the codon chart.
Decode the hidden message. Translate the mRNA into amino acids. Use only the letter for the amino acid.