A CpG sequence is a sequence of DNA where cytosine is followed by guanine in a 5’->3’ direction. Which of these bases can be directly methylated?

A DNA fragment with the following base sequence has some cytosine bases that are methylated (indicated by C*) and others that are unmethylated. To determine the locations of methylated and unmethylated cytosines, researchers sequenced this fragment both with and without treatment with sodium bisulfite. Give the sequence of bases that will be read with and without bisulfite treatment. —ATCGC*GTTAC*GTTGC*GTCA—

As you should recall, DNA, when not being actively transcribed, has a double helical structure.  This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein.  The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5'    Q:  Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template   strand?  ______________________________ Q:  Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA:      ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain:  ________--________--________--________--________--________--________--________

In the DNA double-helix structure, the larger of the two grooves formed by the helical twist where certain base pairs are exposed is called the: