. DNA polymerase requires both a template, to be copied, and a primer, which provides a 3' hydroxyl from which polymerase can extend. Yet this molecule supports DNA polymerase activity. Explain. PTGACACAGGTTTAGCCCATCGATGGG-OH
Q: Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein…
A: Transcription is a process from central dogma where a DNA strand is used as a template to synthesize…
Q: Below is a sample of a segment of DNA…(copy from left to right) 3’…
A: Mutation It occurs when a DNA gene is changed in such a way as to alter the genetic message carried…
Q: The inability of DNA polymerase to replicate the ends of linear chromosome in one strand, compare…
A: Introduction The biological process of producing two identical copies of DNA from a single original…
Q: A DNA strand has the following sequence: 5′–GATCCCGATCCGCATACATTTACCAGATCACCACC–3′In which…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: The figure at the right shows a partially drawn replication fork. a) Annotate this figure to show…
A: In DNA replication the replication fork is an active area. When DNA helicase unwinds the double…
Q: Which of the DNA polymerases shown in Table have the ability to proofread?
A: The DNA polymerase enzyme uses a single stranded DNA molecule as a template and causes the synthesis…
Q: List and describe the function of the ten subunits constituting DNA polymerase III. Distinguish…
A: Introduction DNA pol III is the primary enzyme which leads the DNA replication system. It is a…
Q: lentify the various types of DNA repair mechanisms known to counteract the effects of UV Padlatloh.…
A: Photoreactivation repair- It is the recovery of ultraviolet irradiated damages of DNA by visible…
Q: Sketch a LARGE labeled figure showing one replication fork and the synthesis of one leading strand…
A: DNA replication actually takes place at the replication fork. When these two strands are split open…
Q: Is the template strand read in the 5′ to 3′ or the 3′ to 5′ direction?
A: DNA (deoxyribonucleic acid) replication is a semiconservative process where each strand in the…
Q: 1a. What do DNA polymerases need to be able to synthesize a new strand of DNA? In 1970, Fred Sanger…
A: Since there are multiple questions in this particular question, I'll answer the first one for you.…
Q: Suppose that a single DNA base change of an A to a T occurs and is copied during replication. Is…
A: DNA replication is necessary for the survival of the organism.
Q: Describe the Okazaki fragment and its formation in one of the strands of DNA essentiality of their…
A: Only while each strand of DNA is separated from an additional can DNA polymerase activity continue…
Q: 5-ccuaaucg-34 3'-acctgcctataccggattagetetgatectaagcatgte-5" The diagram above shows an RNA primer…
A: Given - RNA primer : B 5'-ccuaaucg-3" C Template strand : A…
Q: The binding of the SSB (single-stranded binding) protein with DNA (deoxyribonucleic acid) and still…
A: Only when both strands of DNA are been allows to separated from one other can state the DNA in the…
Q: Choose the right combination of components required to set up a polymerase chain reaction from the…
A: Polymerase chain reaction is a method widely used to rapidly make millions to billions of copies of…
Q: Consider the following segment of DNA, which is part ofa much longer molecule constituting a…
A: Deoxyribonucleic acid, or DNA, could be a molecule that contains the directions AN organism must…
Q: All known DNA polymerases catalyze synthesis only in the 5' → 3' direction. Nevertheless, during…
A: DNA replication is the process of making two identical copies of DNA. The process is carried by the…
Q: Spontaneous oxidative deamination of guanine produces the base xanthine (see figure, which also…
A: As per the Watson-Crick model of the DNA double helix:DNA is made up of two strands of…
Q: All guanines in the top strand of following sequence undergo a chemical change so that they now pair…
A: Two identical DNA molecules, each made up of one original strand (the template strand) and one…
Q: Below is a template strand (top) being replicated by DNA polymerase. The black arrow is pointing…
A: DNA is the genetic material of almost all living organisms. It contains the information that is…
Q: Given a part of DNA undergoing replication. Copy and write the . CTGATTCCGAA TG5 corresponding bases…
A: By DNA replication process, cell duplicates its DNA copy and is essential for transfer of equal…
Q: GAATTC GAATTO CITAAG CITAAG double-stranded DNA DAATT DAATTO CTAA G CTAA GI AAT TO CTTAA GAATTO…
A: The cloning is routinely used in biotechnology laboratories and it is the process by which a foreign…
Q: From standpoint of replication and transcription, explain how RNA polymerase is allowed to…
A: DNA is a double standard molecule. RNA is a single standard molecule. RNA is formed from DNA…
Q: The statement "Primase is a sloppy enzyme that makes many mistakes. Eventually, the RNA primer it…
A: The short RNA primers are produced by DNA primase on the lagging strand. DNA serves as the model in…
Q: The epsilon subunit of DNA polymerase III is responsible for its _______ activity. A-5'---->3'…
A: DNA Polymerase III is an enzyme that is involved in DNA replication and synthesis. It has 3'-5'…
Q: Rank from the first to the last steps in DNA synthesis. Reset H DNA polymerase DNA strands separate…
A: The process by which a DNA molecule makes its own identical copy e is called as DNA replication . It…
Q: a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS…
A: DNA replication is a phenomenon in which DNA make itself using Enzyme DNA Polymerase . It occurs in…
Q: pol III moves 5 pol I replaces primer A with DNA pol I binds to 5 end of primer A DNA ligase links…
A: DNA replication is the biological process of producing two identical replicas of DNA from one…
Q: Explain why the absorption of UV light by double-stranded DNA increases (the hyperchromic effect)…
A: Hyperchromicity is the effect of the increase in the absorbance of the molecule.
Q: A single (+) strand of DNA (base composition: A, 21%; G, 29%; C, 29%; T, 21%) is replicated by DNA…
A: Hi, Thanks For Your Question. Answer : DNA Is The Genetic Material Which Stores All The Biological…
Q: elow is a depiction of a replication bubble. 5' AGCTCCGATCGCGTAACTTT 3' TCGAGGCTAGCGCATTGAAA…
A: Without the enzymes, DNA replication is incomplete. The initiation, elongation, termination, and…
Q: The image below shows the replication bubble of a piece of DNA in the process of replication.…
A: DNA replication is the process to make copies of DNA. The new DNA strands are always synthesized…
Q: BamHI cut sequence: G//GATCC and each sequence is 250 nucleotides long. How many DNA segments would…
A:
Q: Given the template DNA strand 3’-TACCCTCAAGGGCAAACT-5’, provide the complimentary DNA strand, mRNA,…
A: DNA is the genetic material of almost all living organisms. The DNA is inherited from the parents…
Q: A DNA synthesizer “machine” is used to create short single stranded DNA of any given sequence. You…
A: A Deoxyribonucleic acid (DNA) synthesizer machine used for generating shorter segments of DNA that…
Q: the following statements are correct about the repair of a Coli (select all that apply)? Strand A…
A: The DNA replication process is exceptionally accurate, but it is not completely infallible. Errors…
Q: Here is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino…
A: For the synthesis of protein first template strand of DNA is made from coding strand of DNA.…
Q: Please match the following enzymes with their correct functions. Primase, Gyrase, Ligase,…
A: Primase :-3. Synthesizes a short RNA to provide a 3’ -OH group for the attachment of DNA…
Q: Although DNA polymerases require both a template and a primer, the following single-stranded…
A: The single stranded DNA can fold back and base-pair with itself, thus providing both template and…
Q: DNA polymerase error rates can be 10-8 to 10° per nucleotide, and mutations in the repair functions…
A: DNA polymerase is an enzyme responsible for the replication of DNA. It catalyzes the polymerization…
Q: Using the data. Which genes have successful transduction？successful PCR？
A: Through the method of transduction, a virus or other viral vector introduces foreign DNA into a…
Q: Translesion synthesis (TLS)
A: When the DNA is damaged during the process of replication, a special phenomenon called Translesion…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet, this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG -OHFrom standpoint of replication and transcription, explain how RNA polymerase is allowed to incorporate the first nucleotide whereas DNA polymerase needs a primer. Explain how this difference impacts the process of replication and transcription.Formation ofa recombinant DNA molecule. GAATTC GAATTC CITAAG CITAAG double-stranded DNA DAATTO DAATTO CTTAA OG CTAA AATT GI AATT CTTAA GAARIC CTTAAG The enzyme that cataly zes the joining of fragments to form recombin ant DNA is: DNA polymerase DNA ligase helicase re striction endonuclease
- Proof-reading during DNA replication refers to: * O removal of thymine dimers by by excision repair O none of the above checking for correct base pairing by DNA polymerase removal of the RNA primer before connecting Okazaki fragments O pairing of A with T and G with C by DNA polymeraseGive correct detailed Solution with explanation needed...don't give Handwritten answer..don't use Ai for answering this. Don't copy answer anywherevvnicn the following statements are correct about the repair of a DNA duplex containing the sequence below that is grown INE coli (select all that apply)? Strand A Strand B GATCTAGCCGGCATCCGAT CTAGATCGGACGTAGGCTA Methyl ✔A. MutH cleaves Strand A O B. DNA repair will result in the bold A in strand B being replaced with a C O C. DNA repair will result in the bold G in strand A being replaced with a T ✔ D. Defect will not be properly repaired in dam(-) E coli O E. The mammalian repair system would also correct the mismatch shown based on the methylation status of the DNA
- Polymerases usually add only about 10 nucleotides toa DNA strand before dissociating. However, during replication, DNA pol III can add tens of thousands ofnucleotides at a moving fork. How is this additionaccomplished?Compare and contrast the properties of DNA polymerase and RNA polymerase. Drag the appropriate items to their respective bins. can proofread using a 3'-to-5' exonuclease activity polymerize in a 5'-to-3' direction Only RNA can initiate strand synthesis catalyze phosphodiester bond formation to polymerize nucleotides into nucleic acids Only DNA use deoxyribonucleotide triphosphates as substrates can only extend an existing strand Both Reset Help dependent on a DNA sequence template use ribonucleotide triphosphates as substratesBelow is a depiction of a replication bubble. 5' AGCTCCGATCGCGTAACTTT 3' TCGAGGCTAGCGCATTGAAA CTAAAGCTTCGGGCATTATCG 3' GATTTCGAAGCCCGTAATAGC TATCGACS Consider the following primer which binds to the DNA replication bubble on the diagram above: 5'-GCUAUCG-3' Identify the DNA sequence to which this primer would bind and the orientation. If the replication fork moves to the right, will the primer be used to create the leading strand of replication or the lagging strand? Explain your answer b. If the replication fork moves to the left, will the primer be used to create the leading strand of replication or a. the lagging strand? Explain your answer. What would the next five nucleotides added to the primer by DNA polymerase? С.
