. DNA polymerase requires both a template, to be copied, and a primer, which provides a 3' hydroxyl from which polymerase can extend. Yet this molecule supports DNA polymerase activity. Explain. PTGACACAGGTTTAGCCCATCGATGGG-OH

. DNA polymerase requires both a template, to be copied, and a primer, which provides a 3' hydroxyl from which polymerase can extend. Yet this molecule supports DNA polymerase activity. Explain. PTGACACAGGTTTAGCCCATCGATGGG-OH

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 18QP: Replication involves a period of time during which DNA is particularly susceptible to the...

See similar textbooks

Related questions

Q: Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein…

A: Transcription is a process from central dogma where a DNA strand is used as a template to synthesize…

Q: Below is a sample of a segment of DNA…(copy from left to right) 3’…

A: Mutation It occurs when a DNA gene is changed in such a way as to alter the genetic message carried…

Q: A DNA strand has the following sequence: 5′–GATCCCGATCCGCATACATTTACCAGATCACCACC–3′In which…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: The figure at the right shows a partially drawn replication fork. a) Annotate this figure to show…

A: In DNA replication the replication fork is an active area. When DNA helicase unwinds the double…

Q: Which of the DNA polymerases shown in Table have the ability to proofread?

A: The DNA polymerase enzyme uses a single stranded DNA molecule as a template and causes the synthesis…

Q: List and describe the function of the ten subunits constituting DNA polymerase III. Distinguish…

A: Introduction DNA pol III is the primary enzyme which leads the DNA replication system. It is a…

Q: lentify the various types of DNA repair mechanisms known to counteract the effects of UV Padlatloh.…

A: Photoreactivation repair- It is the recovery of ultraviolet irradiated damages of DNA by visible…

Q: Sketch a LARGE labeled figure showing one replication fork and the synthesis of one leading strand…

A: DNA replication actually takes place at the replication fork. When these two strands are split open…

Q: Is the template strand read in the 5′ to 3′ or the 3′ to 5′ direction?

A: DNA (deoxyribonucleic acid) replication is a semiconservative process where each strand in the…

Q: Suppose that a single DNA base change of an A to a T occurs and is copied during replication. Is…

A: DNA replication is necessary for the survival of the organism.

Q: Consider the following segment of DNA, which is part ofa much longer molecule constituting a…

A: Deoxyribonucleic acid, or DNA, could be a molecule that contains the directions AN organism must…

Q: All known DNA polymerases catalyze synthesis only in the 5' → 3' direction. Nevertheless, during…

A: DNA replication is the process of making two identical copies of DNA. The process is carried by the…

Q: Spontaneous oxidative deamination of guanine produces the base xanthine (see figure, which also…

A: As per the Watson-Crick model of the DNA double helix:DNA is made up of two strands of…

Q: All guanines in the top strand of following sequence undergo a chemical change so that they now pair…

A: Two identical DNA molecules, each made up of one original strand (the template strand) and one…

Q: Below is a template strand (top) being replicated by DNA polymerase. The black arrow is pointing…

A: DNA is the genetic material of almost all living organisms. It contains the information that is…

Q: Given a part of DNA undergoing replication. Copy and write the . CTGATTCCGAA TG5 corresponding bases…

A: By DNA replication process, cell duplicates its DNA copy and is essential for transfer of equal…

Q: The statement "Primase is a sloppy enzyme that makes many mistakes. Eventually, the RNA primer it…

A: The short RNA primers are produced by DNA primase on the lagging strand. DNA serves as the model in…

Q: The epsilon subunit of DNA polymerase III is responsible for its _______ activity. A-5'---->3'…

A: DNA Polymerase III is an enzyme that is involved in DNA replication and synthesis. It has 3'-5'…

Q: Rank from the first to the last steps in DNA synthesis. Reset H DNA polymerase DNA strands separate…

A: The process by which a DNA molecule makes its own identical copy e is called as DNA replication . It…

Q: a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS…

A: DNA replication is a phenomenon in which DNA make itself using Enzyme DNA Polymerase . It occurs in…

Q: A single (+) strand of DNA (base composition: A, 21%; G, 29%; C, 29%; T, 21%) is replicated by DNA…

A: Hi, Thanks For Your Question. Answer : DNA Is The Genetic Material Which Stores All The Biological…

Q: elow is a depiction of a replication bubble. 5' AGCTCCGATCGCGTAACTTT 3' TCGAGGCTAGCGCATTGAAA…

A: Without the enzymes, DNA replication is incomplete. The initiation, elongation, termination, and…

Q: The image below shows the replication bubble of a piece of DNA in the process of replication.…

A: DNA replication is the process to make copies of DNA. The new DNA strands are always synthesized…

Q: BamHI cut sequence: G//GATCC and each sequence is 250 nucleotides long. How many DNA segments would…

Q: Given the template DNA strand 3’-TACCCTCAAGGGCAAACT-5’, provide the complimentary DNA strand, mRNA,…

A: DNA is the genetic material of almost all living organisms. The DNA is inherited from the parents…

Q: A DNA synthesizer “machine” is used to create short single stranded DNA of any given sequence. You…

A: A Deoxyribonucleic acid (DNA) synthesizer machine used for generating shorter segments of DNA that…

Q: the following statements are correct about the repair of a Coli (select all that apply)? Strand A…

A: The DNA replication process is exceptionally accurate, but it is not completely infallible. Errors…

Q: Here is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino…

A: For the synthesis of protein first template strand of DNA is made from coding strand of DNA.…

Q: Please match the following enzymes with their correct functions. Primase, Gyrase, Ligase,…

A: Primase :-3. Synthesizes a short RNA to provide a 3’ -OH group for the attachment of DNA…

Q: Although DNA polymerases require both a template and a primer, the following single-stranded…

A: The single stranded DNA can fold back and base-pair with itself, thus providing both template and…

Q: DNA polymerase error rates can be 10-8 to 10° per nucleotide, and mutations in the repair functions…

A: DNA polymerase is an enzyme responsible for the replication of DNA. It catalyzes the polymerization…

Q: Translesion synthesis (TLS)

A: When the DNA is damaged during the process of replication, a special phenomenon called Translesion…

Question

. DNA polymerase requires both a template, to be copied, and a primer, which
provides a 3' hydroxyl from which polymerase can extend. Yet this molecule
supports DNA polymerase activity. Explain.
PTGACACAGGTTTAGCCCATCGATGGG-OH

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet, this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG -OH
DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG−OH Match the items in the left column to the appropriate blanks in the sentence on the right.
Describe the function of DNA polymerase. Explain why each part of the name DNA polymerase (DNA, polymer, -ase) makes sense.
Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
Suppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in the sequence, and before the gaps were repaired, the fragment in the middle was inverted. Show the sequence of the repaired DNA molecule. Keep the 5’-3’ polarity of the DNA strands and DNA polymerases in mind.) 5’- TAAGCGTAACACGCTAA CAGTAATGCAGAACT GGGTCCTATTTTCGTGCGTACAC – 3’ 3’- ATTCGCATTGTGCGATT GTCATTACGTCTTGA CCCAGGATAAAAGCACGCATGTG -5’ Please note that there are 2 gaps. The second one is between the lines (between T & G in the 1st strand and A & C in the second strand)
Give correct detailed Solution with explanation needed...don't give Handwritten answer..don't use Ai for answering this. Don't copy answer anywhere
vvnicn the following statements are correct about the repair of a DNA duplex containing the sequence below that is grown INE coli (select all that apply)? Strand A Strand B GATCTAGCCGGCATCCGAT CTAGATCGGACGTAGGCTA Methyl ✔A. MutH cleaves Strand A O B. DNA repair will result in the bold A in strand B being replaced with a C O C. DNA repair will result in the bold G in strand A being replaced with a T ✔ D. Defect will not be properly repaired in dam(-) E coli O E. The mammalian repair system would also correct the mismatch shown based on the methylation status of the DNA
Can someone example why it’s dctp im confused ;&;;$;;$;$$:
Compare and contrast the properties of DNA polymerase and RNA polymerase. Drag the appropriate items to their respective bins. can proofread using a 3'-to-5' exonuclease activity polymerize in a 5'-to-3' direction Only RNA can initiate strand synthesis catalyze phosphodiester bond formation to polymerize nucleotides into nucleic acids Only DNA use deoxyribonucleotide triphosphates as substrates can only extend an existing strand Both Reset Help dependent on a DNA sequence template use ribonucleotide triphosphates as substrates
Below is a depiction of a replication bubble. 5' AGCTCCGATCGCGTAACTTT 3' TCGAGGCTAGCGCATTGAAA CTAAAGCTTCGGGCATTATCG 3' GATTTCGAAGCCCGTAATAGC TATCGACS Consider the following primer which binds to the DNA replication bubble on the diagram above: 5'-GCUAUCG-3' Identify the DNA sequence to which this primer would bind and the orientation. If the replication fork moves to the right, will the primer be used to create the leading strand of replication or the lagging strand? Explain your answer b. If the replication fork moves to the left, will the primer be used to create the leading strand of replication or a. the lagging strand? Explain your answer. What would the next five nucleotides added to the primer by DNA polymerase? С.
Genetics Attached is a segment of DNA (doublestranded). Answer the following questions about the segment of DNA: How many open reading frames (ORF) are in this sequence? How many amino acids are encoded in all open reading frames in this segment/sequence? Which strand is the template strand for the longest open reading frame?
DNA Replication For the following piece of DNA, draw the replicated piece of DNA show me where the original and replicated strands of DNA end up. A ATCCGTTACCCA A ACGATATC C GTTA AC C GC G ITAG GCA ATGG GTTTG CTATAG GCA ATTGG C G C