Consider the following segment of DNA, which is part ofa much longer molecule constituting a chromosome:5′.…ATTCGTACGATCGACTGACTGACAGTC….3′3′.…TAAGCATGCTAGCTGACTGACTGTCAG….5′If the DNA polymerase starts replicating this segmentfrom the right,a. which will be the template for the leading strand?b. Draw the molecule when the DNA polymerase ishalfway along this segment.c. Draw the two complete daughter molecules.d. Is your diagram in part b compatible with bidirectional replication from a single origin, the usual modeof replication?
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Consider the following segment of DNA, which is part of
a much longer molecule constituting a chromosome:
5′.…ATTCGTACGATCGACTGACTGACAGTC….3′
3′.…TAAGCATGCTAGCTGACTGACTGTCAG….5′
If the DNA polymerase starts replicating this segment
from the right,
a. which will be the template for the leading strand?
b. Draw the molecule when the DNA polymerase is
halfway along this segment.
c. Draw the two complete daughter molecules.
d. Is your diagram in part b compatible with bidirectional replication from a single origin, the usual mode
of replication?

Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images









