In the diagram of DNA at the right: a) fill in the letters representing the bases on the right-hand strand. b) How many nucleotides are shown? 6 c) Explain why these two strands are described as "anti-parallel." because twee stands in apposite directions d) If the DNA strand on the left is the coding strand, what mRNA sequence would be transcribed from it? ACG e) What amino acid would that mRNA strand code for? (read the letters from top to bottom) (The) threonine 1' 2' 1' 2 AT CHG GHC

Q: Which of the following is NOT true regarding the genetic code and translation? a) An mRNA is…

A: Deoxyribonucleic acid or DNA is a type of nucleic acid that is present in the nucleus of the cell.…

Q: The diagram shows part of a pre-mRNA molecule. A G part X (a) (i) Name the two substances that make…

A: Within the cells two types of nucleic acids are found, that are DNA and RNA. They both composed of…

Q: The function of RNA polymerase is to A) catalyze the formation of phosphodiester bonds between…

A: Gene expression is the process thorough which the DNA directs to form proteins. It involves two…

Q: 4) where in the cell they occur, 2) one important protein (or protein containing complex) involved…

A: DNA Replication: Where : Nucleus Protein : Pre-replication complex (ORC1-6, Cdc6, Cdt 1 and MCM2-7…

Q: Compare the process of Replication, Transcription, and Translation by describing the following…

A: In the molecular biology, the genetic information is encoded in the DNA. Central dogma consists of…

Q: Which of the following parts of translation is significantly different in eukaryotes and…

A: mRNA or messenger RNA carries genetic information as nucleotide sequence copied from template DNA…

Q: b) Draw a diagram to show how nucleotides are organised in the structure of DNA. Note: You need only…

A: The four most important biomolecules in living things are carbohydrates, amino acids, lipids, and…

Q: During replication the primer contains O a) a short segment of DNA-RNA hybrid nucleotides Ob) none…

A: Replication refers to the process by which a DNA molecule makes an exact copy of itself. This…

Q: In DNA replication, there are leading and lagging strands because A) DNA replication is…

A: DNA replication is the process by which the genetic material of the cell is doubled which is then…

Q: Spliceosomes play central roles in .. a) removal of exons from pre-mRNA b) removal of introns from…

A: The mRNA transcribed from the DNA is heterogeneous mRNa or pre mRna which is not the final product.…

Q: Which of these molecules would have the most monomers (i.e. be longest)? a) RNA polymer that…

A: Nucleic acids are involved in various processes in the cell, their main role is the expression of…

Q: a) Which strand is coding strand? b) What is the sequence of the encoded polypeptide? A mutant…

A: The central dogma of molecular biology involves the synthesis of a polypeptide chain of amino acids,…

Q: Match the function in translation to each type of RNA (one RNA has two listed functions). 1) Carry…

A: The process where RNA transformed into protein called translation. There are all three types of…

Q: b) What is the MRNA sequence that would be created from the DNA template sequence above?…

A: Cell is the basic structural and functional unit of life. All the cells contains the nucleus with…

Q: a) Are codons found in DNA or RNA? b) How many bases are in a codon? c) Give an example of a codon.

A: A codon is a DNA or RNA trinucleotide sequence that refers to a certain amino acid.

Q: 3) During charging of tRNAS Select an answer and submit. For keyboard navigation, use the up/down…

A: The translation is a process by which proteins are synthesized. It is the last step of the central…

Q: Consider a portion of a gene in a cell with the sequence TTTTT. Which of the following bases would…

A: The correct answer is C) A-A-A-A-A; nucleus .

Q: Deamination of adenine results in the formation of hypoxanthine. Hypoxanthine selectively base pairs…

A: The question is asking about the potential outcome of a specific type of mutation in DNA,…

Q: 1a) Name the start codon and the three stop codons for translation. 1b) What amino acid is…

A: An mRNA codon is a triplet or triple-nucleotide sequence that codes for a certain amino acid during…

Q: A nucleotide sequence in a segment of a DNA information strand is given here. Sketch (A) the…

A:

Q: Below is a template strand of DNA. Assume the transcription start site is outside of this sequence…

A: Transcription is the initial phase in gene expression, where data from a gene is utilized to develop…

Q: Which of the following is NOT correct concerning the initiation of replication in E. coli?…

A: In E.coli, the DNA replication takes place by the binding of DnaA to the OriC (the origin of…

Q: onsider the following segment of DNA, which is part of a linear chromosome: LEFT…

A: Answer.  Transcription is a process of the formation of transcript (RNA). It takes place by the…

Q: In the diagram of replication shown here, fill in the blanks with the appropriate terms: (a) base…

A: Transmission of chromosomal DNA from generation to generation is crucial to cell propagation. This…

Q: For translation of eukaryotic mRNA sequences: a) The stop codon stops translation by blocking the…

A: Translation refers to the process of polymerisation of amino acid to form a polypeptide. The order…

Q: DNA strands that can form a double helix are said to be Select an answer and submit. For keyboard…

A: Deoxyribose Nucleic Acid or DNA is a double-stranded molecule with the shape of a twisted ladder.

Q: Do any strands of nucleic acid exist in nature in which part of the strand is DNA and part is RNA?…

A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms (except few viruses) that…

Q: A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: a) DNA fragment with instructions b) code c) is transcribed but not translated d) non-coding e)…

A: DNA, or deoxyribonucleic acid, is a molecule that contains the instructions an organism needs to…

Q: Which of the following mutations of the DNA sequence TTT TÁC ÁCT would potentially have the least…

A: The genetic information from the DNA is first transcribed into mRNA. The mRNA contains codons, which…

Q: Transcribe the following DNA sequence into codons.…

A: Transcription is a process in which there is formation of messenger RNA from the DNA template In…

Q: Which of the following DNAs is most likely to contain the recognition sequence for a homodimeric DNA…

A: Ans - a.)  5’- G A G C G A T C G C T C - 3’                       3'- C  T C G C T A G C G A G -5'…

Q: Which of the following sequences in the coding strand of the DNA could code for this peptide? Select…

A: Amino acids are coded by codons (trinucleotide sequences of DNA or RNA). Specific codons code for…

Q: ) A bacterial chromosome contains 6.4 million nucleotides of DNA. If synthesis at each replication…

A: 1. It is given that a bacterial chromosome contains 6.4 million nucleotides of DNA. Suppose…

Q: Which of these represents the correct order of events going from DNA to Protein? a) Transcription,…

A: False  B is not an okazaki  fragment  C represents the okazaki fragments.  Okazaki fragments are…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.