The diagram shows part of a pre-mRNA molecule. A G part X (a) (i) Name the two substances that make up part X. (ii) Give the sequence of bases on the DNA strand from which this pre-mRNA has been transcribed. (b) (i) Give one way in which the structure of an MRNA molecule is different from the structure of a tRNA molecule. (ii) Explain the difference between pre-mRNA and mRNA. (c) The table shows the percentage of different bases in two pre-mRNA molecules. The molecules were transcribed from the DNA in different parts of a chromosome. Part of Percentage of base chromosome A G U Middle 38 20 24 End 31 22 26

Q: In the diagram of DNA at the right: a) fill in the letters representing the bases on the right-hand…

A: Introduction :  The genetic material in most organisms is DNA or Deoxyribonucleic acid. The…

Q: 1)post translational  processing of polypeptide chains including…

A: Protein synthesis or translation is the process by which mRNA is translated into protein using tRNA…

Q: Spliceosomes play central roles in .. a) removal of exons from pre-mRNA b) removal of introns from…

A: The mRNA transcribed from the DNA is heterogeneous mRNa or pre mRna which is not the final product.…

Q: b) What is the MRNA sequence that would be created from the DNA template sequence above?…

A: Cell is the basic structural and functional unit of life. All the cells contains the nucleus with…

Q: The sequence below (A) was read from the autoradiogram (B). (A) 5'…

A: Note: since you have asked multiple unrelated questions, as per the honor code we are answering the…

Q: . Suppose that a gene underwent a mutation that changed a GAA codon to UAA. (a) Name the amino acid…

A: A codon is a sequence of three DNA or RNA nucleotides that corresponds with a specific amino acid or…

Q: (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT…

A: Introduction :- Mutations are the hereditary changes that occurs in the Genetic material (DNA) of…

Q: 2. In the cytoplasm of the cell below, four tRNA molecules are carrying amino acids. a) What amino…

A: Translation is a 2 step process where nucleotide sequence transcribed from DNA present inside…

Q: A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: 1. Explain why DNA fragments can be separated using an electric current. How does the size of the…

A: 1.DNA fragments can be separated by the application of current this process of separating DNA occurs…

Q: (a)In conjugates_ determines the specificity of the enzyme (b)Protein biosynthesis is a complex…

A: Enzymes are the catalyst for the biochemical reaction. It helps in increasing the rate of reaction…

Q: A piece of mRNA is moving along the ribosome.  Which amino acid would bind if the mRNA read....…

A: The process of protein synthesis is called translation. It occurs on ribosomes bound to mRNA in the…

Q: 1. The following is showing the process of translation with MRNA, TRNA and a ribosome. a) Label the…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: What is the function of the poly(A) tail that is added to mRNA in eukaryotic cells? a) to prevent…

A: During mRNA processing,there are several types of 3' modifications that can occur on mRNA, including…

Q: If a protein is made up of 1000 amino acids   1) How many nucleotides will its mRNA contain…

A: Amino acids are the building blocks of proteins, which are responsible for the expression of genes.…

Q: Label the features of a tRNA by dragging the labels to the correct targets. A Binds an amino acid B.…

A: tRNA is also known as transfer RNA which helps in the transfer of amino acid to the mRNA codon…

Q: . Translation a)Explain the role of ribosomes in the process of protein translation.b. Explain the…

A: “Since you have asked a question with multiple sub-parts, we will solve the first three sub-parts…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.