The diagram shows part of a pre-mRNA molecule. A G part X (a) (i) Name the two substances that make up part X. (ii) Give the sequence of bases on the DNA strand from which this pre-mRNA has been transcribed. (b) (i) Give one way in which the structure of an MRNA molecule is different from the structure of a tRNA molecule. (ii) Explain the difference between pre-mRNA and mRNA. (c) The table shows the percentage of different bases in two pre-mRNA molecules. The molecules were transcribed from the DNA in different parts of a chromosome. Part of Percentage of base chromosome A G U Middle 38 20 24 End 31 22 26

Q: Which of the following best explains the mechanism of action of this drug?

A: These drugs have a neucleus of four cyclic rings. They are obtained from actinomycetes of soil.…

Q: Given the amino acid chain below, get the (a) translation strand, (b) transcription strand strand,…

A: DNA is double stranded. There one strand is the template strand and the other is non-template. From…

Q: In the diagram of DNA at the right: a) fill in the letters representing the bases on the right-hand…

A: Introduction :  The genetic material in most organisms is DNA or Deoxyribonucleic acid. The…

Q: 1)post translational  processing of polypeptide chains including…

A: Protein synthesis or translation is the process by which mRNA is translated into protein using tRNA…

Q: Spliceosomes play central roles in .. a) removal of exons from pre-mRNA b) removal of introns from…

A: The mRNA transcribed from the DNA is heterogeneous mRNa or pre mRna which is not the final product.…

Q: b) What is the MRNA sequence that would be created from the DNA template sequence above?…

A: Cell is the basic structural and functional unit of life. All the cells contains the nucleus with…

Q: What type of RNA carries the genetic informationrequired for protein synthesis?(a) Transfer RNA(b)…

A: DNA contains the instructions for protein synthesis. Function of proteins is to determine structure…

Q: the gene above is transcribed into a functional mRNA, a.) how many codons will be carried by the…

A: The process of formation of messenger RNA with the help of template strand of DNA is called…

Q: They are related in str They have identical ba C) they are the result of a

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: 1. If the gene above is transcribed into a functional mRNA,  a.) how many codons will be carried by…

A: a) 64 codons will be carried by the functional mRNA, 61 represent amino acids, and the remaining…

Q: The sequence below (A) was read from the autoradiogram (B). (A) 5'…

A: Note: since you have asked multiple unrelated questions, as per the honor code we are answering the…

Q: 16) PROTEIN SYNTHESIS: A) Describe the process of protein synthesis. Be sure to use transcription…

A: Proteins are polymers of amino acids formed via peptide bond between two amino acids .

Q: . Suppose that a gene underwent a mutation that changed a GAA codon to UAA. (a) Name the amino acid…

A: A codon is a sequence of three DNA or RNA nucleotides that corresponds with a specific amino acid or…

Q: (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT…

A: Introduction :- Mutations are the hereditary changes that occurs in the Genetic material (DNA) of…

Q: A ribosome binds to the following mRNA at the site indicatedby the dark box. At which codon will…

A: The mRNA strands obtained after the transcription of the antisense DNA strand (also known as the…

Q: the rol (c) What is translation? Explain codons in this process. (d) Provide the structure (with…

A: Translation is defined as a process of formation of amino acid chains from the code dictated by the…

Q: 2. In the cytoplasm of the cell below, four tRNA molecules are carrying amino acids. a) What amino…

A: Translation is a 2 step process where nucleotide sequence transcribed from DNA present inside…

Q: A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: What is translation? Explain the role of codons in this process.

A: Note: As Per Bartleby Guidelines only one question is answered. For further answers repost the…

Q: How to transfer biological information in protein synthesis? What is the link between DNA and…

A: Central Dogma is a flow of information that is present in the form of nucleotide sequence on the DNA…

Q: 1. Explain why DNA fragments can be separated using an electric current. How does the size of the…

A: 1.DNA fragments can be separated by the application of current this process of separating DNA occurs…

Q: During protein synthesis, one amino acid binds to RNA molecules. a) What is this RNA molecule? b)…

A: The process of formation of Amino acids from mRNA molecule is known as translation.

Q: (a)In conjugates_ determines the specificity of the enzyme (b)Protein biosynthesis is a complex…

A: Enzymes are the catalyst for the biochemical reaction. It helps in increasing the rate of reaction…

Q: A piece of mRNA is moving along the ribosome.  Which amino acid would bind if the mRNA read....…

A: The process of protein synthesis is called translation. It occurs on ribosomes bound to mRNA in the…

Q: 1. The following is showing the process of translation with MRNA, TRNA and a ribosome. a) Label the…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: What is the function of the poly(A) tail that is added to mRNA in eukaryotic cells? a) to prevent…

A: During mRNA processing,there are several types of 3' modifications that can occur on mRNA, including…

Q: If a protein is made up of 1000 amino acids   1) How many nucleotides will its mRNA contain…

A: Amino acids are the building blocks of proteins, which are responsible for the expression of genes.…

Q: 4. (a) Create the complementary strand for the DNA strand below. Make sure to write the direction of…

A: DNA is a polynucleotide molecule that stores genetic and hereditary information. DNA is a…

Q: Label the features of a tRNA by dragging the labels to the correct targets. A Binds an amino acid B.…

A: tRNA is also known as transfer RNA which helps in the transfer of amino acid to the mRNA codon…

Q: . Translation a)Explain the role of ribosomes in the process of protein translation.b. Explain the…

A: “Since you have asked a question with multiple sub-parts, we will solve the first three sub-parts…

Q: 9) Which statement is inaccurate (wrong) about mRNA? A) it is double stranded and has thymine B) it…

A: The explanation for the wrong statement is given below.

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.