The diagram shows part of a pre-mRNA molecule. A G part X (a) (i) Name the two substances that make up part X. (ii) Give the sequence of bases on the DNA strand from which this pre-mRNA has been transcribed. (b) (i) Give one way in which the structure of an MRNA molecule is different from the structure of a tRNA molecule. (ii) Explain the difference between pre-mRNA and mRNA. (c) The table shows the percentage of different bases in two pre-mRNA molecules. The molecules were transcribed from the DNA in different parts of a chromosome. Part of Percentage of base chromosome A G U Middle 38 20 24 End 31 22 26

Q: A synthetic mRNA was made by linking together 5 G-A 3' dinucleotides. Which amino acid(s) would be…

A: The key enzyme involved in transcription is RNA polymerase, which synthesises a complementary strand…

Q: 1)post translational  processing of polypeptide chains including…

A: Protein synthesis or translation is the process by which mRNA is translated into protein using tRNA…

Q: b) What is the MRNA sequence that would be created from the DNA template sequence above?…

A: Cell is the basic structural and functional unit of life. All the cells contains the nucleus with…

Q: What type of RNA carries the genetic informationrequired for protein synthesis?(a) Transfer RNA(b)…

A: DNA contains the instructions for protein synthesis. Function of proteins is to determine structure…

Q: the gene above is transcribed into a functional mRNA, a.) how many codons will be carried by the…

A: The process of formation of messenger RNA with the help of template strand of DNA is called…

Q: They are related in str They have identical ba C) they are the result of a

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: 1. If the gene above is transcribed into a functional mRNA,  a.) how many codons will be carried by…

A: a) 64 codons will be carried by the functional mRNA, 61 represent amino acids, and the remaining…

Q: (2) (a) Using the codon table, show the consequences of adenine base addition to thebeginning of the…

A: The genetic code is a set of instructions that enable living cells to produce proteins from genetic…

Q: The sequence below (A) was read from the autoradiogram (B). (A) 5'…

A: Note: since you have asked multiple unrelated questions, as per the honor code we are answering the…

Q: . Suppose that a gene underwent a mutation that changed a GAA codon to UAA. (a) Name the amino acid…

A: A codon is a sequence of three DNA or RNA nucleotides that corresponds with a specific amino acid or…

Q: If DNA codes for mRNA and mRNA codes for protein, then how can the same DNA sequence generate…

A: If DNA codes for mRNA and mRNA codes for protein, then how can the same DNA sequence generate…

Q: the sequences od tRNA and corresponding mRNA  is complementary to each other. is the statement true…

A: The synthesis of a functional protein involves two processes namely transcription and translation.…

Q: 1a) Name the start codon and the three stop codons for translation. 1b) What amino acid is…

A: An mRNA codon is a triplet or triple-nucleotide sequence that codes for a certain amino acid during…

Q: A ribosome binds to the following mRNA at the site indicatedby the dark box. At which codon will…

A: The mRNA strands obtained after the transcription of the antisense DNA strand (also known as the…

Q: Is there any complementarity between DNA and a transcribed mRNA? In which direction is the mRNA…

A: The transcription is a process by which mRNA is produced from the DNA. In case of prokaryotic…

Q: Both fl agella and cilia are found primarily in a. algae c. fungi b. protozoa d. both b and c

A: Cilia and flagella both are the characteristics which are required for the locomotion of the…

Q: In the: Inhibition of splicing by ribozymes Explain: (a) What is the process affected? (b) What is…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Below is a template strand of DNA. Assume the transcription start site is outside of this sequence…

A: Transcription is the initial phase in gene expression, where data from a gene is utilized to develop…

Q: the rol (c) What is translation? Explain codons in this process. (d) Provide the structure (with…

A: Translation is defined as a process of formation of amino acid chains from the code dictated by the…

Q: How is the relationship between the tRNA and mRNA described

A: Messenger RNA is product of transcription process. A process where all the genetic information of…

Q: Translate the mRNA into a protein using the genetic code. (Amino acid chain.)   AUG( met)-UUU(…

A: Introduction The genetic code is a set of instructions that enable live cells to produce proteins…

Q: In which reading frame will this mRNA be read? 5’- A C A G A U G C A A G U C U A A U G A C G - 3’…

A: Ans- b ) 2nd This mRNA will be read in the 2nd reading frame.

Q: A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: What is translation? Explain the role of codons in this process.

A: Note: As Per Bartleby Guidelines only one question is answered. For further answers repost the…

Q: Describe  the relationship between

A: RNA is ribonucleic acid that is a single stranded nucleic acid composed of ribose sugar.  The mRNA…

Q: A piece of mRNA is moving along the ribosome.  Which amino acid would bind if the mRNA read....…

A: The process of protein synthesis is called translation. It occurs on ribosomes bound to mRNA in the…

Q: Explain briefly how translation is initiated from a) prokaryotic mRNA and b) eukaryotic mRNA.…

A: The translation is the process of using the genetic information in mRNA to create a protein. In the…

Q: 1. The following is showing the process of translation with MRNA, TRNA and a ribosome. a) Label the…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Describe regulatory mechanisms for each of the following levels. Give at least on example for each…

A: Answer : A) DNA: - Deoxyribose nucleic acid-- DNA is a long polymer of deoxyribonucleotides, DNA…

Q: The 3 major forms of RNA (mRNA, tRNA, & rRNA) interact during translation. a) Describe the role…

A: Translation is the process of synthesizing a protein from the mRNA. The genetic information in the…

Q: 2a) In prokaryotes, a small ribosomal subunit can potentially get on an mRNA anywhere it can find…

A: The translation is the process of polymerization of amino acids to form polypeptides or protein. It…

Q: a. What polypeptide is coded for by the mRNA sequence: 5'-GCU-GAA-GUC-GAG-GUG-UGG-3'? N-terminus -…

A: A sequence of three consecutive nucleotides in messenger RNA (mRNA) coding for amino acids is…

Q: What is the function of the poly(A) tail that is added to mRNA in eukaryotic cells? a) to prevent…

A: During mRNA processing,there are several types of 3' modifications that can occur on mRNA, including…

Q: If a protein is made up of 1000 amino acids   1) How many nucleotides will its mRNA contain…

A: Amino acids are the building blocks of proteins, which are responsible for the expression of genes.…

Q: . Translation a)Explain the role of ribosomes in the process of protein translation.b. Explain the…

A: “Since you have asked a question with multiple sub-parts, we will solve the first three sub-parts…

Q: Given the amino acid chain below, get the (a) translation strand, (b) transcription strand strand,…

A: Amino acids - are building blocks of proteins and alpha carbon of amino acids contains amine group,…

Q: How is the relationship between the tRNA and mRNA achieved?

A: Proteins are built from smaller units known as amino acids, that are fixed by three-nucleotide mRNA…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.