A single (+) strand of DNA (base composition: A, 21%; G, 29%; C, 29%; T, 21%) is replicated by DNA polymerase to yield a complementary (-) strand. The resulting duplex DNA is then used a template by RNA polymerase, which transcribes the (-) strand. Indicate the base composition of the RNA formed.

A single (+) strand of DNA (base composition: A, 21%; G, 29%; C, 29%; T, 21%) is replicated by DNA polymerase to yield a complementary (-) strand. The resulting duplex DNA is then used a template by RNA polymerase, which transcribes the (-) strand. Indicate the base composition of the RNA formed.

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

The restriction endonuclease NciI recognizes and cuts the five-base-pair sequence 5’- CC(G/C)GG-3’ [where (G/C) means either G or C will work at that position]. (1) How often, on average, would this sequence occur in random DNA? Assume the DNA contains 25% each of A, G, T & C. (2) After digestion, Nci1 leaves a one-base 5’ overhang. Write/draw the cut site/digested products.
All guanines in the top strand of the following sequence are converted from the 'keto' tautomer to the 'enol' tautomer, resulting in pairing with thymine. (top strand) 5' TAGCATGCAA 3' (bottom strand) After a few rounds of replication, what will the sequence of the mutated top strand be? (5' to 3') (Newly incorporated nucleotides are in the 'keto' form.) 3' ATCGTACGTT 5'
Write the complementary strand to the following single-stranded DNA and label the 5' and 3' ends: 5'-ATAGCATGGGCCATACGATTACTGA-3'
A DNA fragment with the following base sequence has some cytosine bases that are methylated (indicated by C*) and others that are unmethylated. To determine the locations of methylated and unmethylated cytosines, researchers sequenced this fragment both with and without treatment with sodium bisulfite. Give the sequence of bases that will be read with and without bisulfite treatment. —ATCGC*GTTAC*GTTGC*GTCA—
If a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "a" side in the phosphodiester bond, what are the consequent nucleotide products of the hydrolysis of the 2 strands? (Please write the answers using only the letters corresponding to the bases with either the p or OH beside it to indicate the phosphate and OH groups respectively.) Sequence in one strand: TCGATCAG Use the editor to format your answer
There are 2 parts to this question: The following DNA strand (below) is about to undergo DNA replication. a) Please replicate the parental strands into two exact copies TC GATATCGG AGCTATAGCC b) place a centromere between the two replicated copies (or tell me where the centromere would be located),
Give only typing answer with explanation and conclusion
DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG−OH Match the items in the left column to the appropriate blanks in the sentence on the right.
Name the enzymes that cut the DNA at specific sequences and create sticky ends.
What is/are the attributes that make nucleotide excision repair (NER) and base excision repair (BER) similar and/or different from each other? Select the correct response: The NER pathway is the only one that can remove DNA lesions in the strand regardless of their size which is followed by attaching the correct strand, then sealed by a DNA ligase. They both use the enzyme DNA glycosylases that recognizes the damaged DNA segments and proceed with repairing the faulty base in the strand. They differ NER only repairs purine bases while BER repairs pyrimidine bases. They both remove the damaged parts of the DNA where the BER pathway corrects only the identified damaged bases which are usually non-bulky lesions. The NER pathway, on the other hand, repairs the damage by removal of bulky DNA adducts which is a short-single stranded DNA segment. They both utilize the enzyme photolyase to reverse the damages created by the faulty section of the DNA. They both remove the damaged parts of the…
A student has drawn an enlarged portion of a DNA “ladder” model to show two of the nucleotides in greater detail (in the same orientation as they would occur in the ladder model). Which two nucleotides did the student draw?
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotidesequences (all belong to an exon):5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed that produced a functional mRNA. Assuming there are no mutations, the said mRNA is then brought to the site of protein synthesis,a. what would be the amino acid sequence of the synthesized polypeptide chain?b. how many possible kinds of tRNA molecule that will bring the 2nd amino acid observing wobble hypothesis? List down their anticodons.