A student has drawn an enlarged portion of a DNA “ladder” model to show two of the nucleotides in greater detail (in the same orientation as they would occur in the ladder model). Which two nucleotides did the student draw?

Q: Does Phospodiester bonds hold deoxyribose and phosphate components together in the DNA

A: Ans- true

Q: ONA sequences have an alphabet {A, C,G,T}. How many DNA sequences of length n are there? (Two DNA…

A: Dna is a nucleic acid polymer made of deoxyribonucleotides. It is a bit like a string of letters…

Q: Refer to the attached DNA model.  In the spaces provided on the attached table, identify the…

A: DNA or deoxyribonucleic acid is the genetic material present in most organisms. It is composed of…

Q: In a Sanger DNA sequencing reaction (dideoxy method) you use the primer 5′-GCATATA-3′ to sequence a…

A: Sequencing of DNA refers to the biochemical methods for determining the order of the nucleotide…

Q: Try to explain the function of DNA gyrase with a drawing

A: DNA (deoxyribonucleic acid) gyrase is an essential enzyme present in bacteria. DNA gyrase belongs to…

Q: Identify the major and minor grooves in the DNA molecule PDB ID 141D. In addition, one end of a…

A: The DNA double helix has alternating major and minor grooves. The major groove is wider than the…

Q: perform an experiment to determine the complete melting profile of a relatively long DNA duplex with…

A: Melting temperature is the temperature at which half of the double stranded DNA gets melted out…

Q: A K I D H

A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…

Q: The gel pattern below was produced by the Sanger sequencing method. Determine the sequence…

A: In sanger Sequencing, the products of the nucleotides A, G, C, and T reactions are individually…

Q: Write the sequence of a different six nucleotide palindromic DNA sequence that uses all four…

A: Palindromic DNA sequences are read the same on both DNA strands from the similar end. For example,…

Q: Based on your gel, how big are the DNA fragments in each lane? Enter your results in Table 2.

A: Molecular weight of the bands are measured by comparing it with the ladder whose bands molecular…

Q: 5)(comprehension) In double-stranded DNA, which of the following base RATIOS ALWAYS EQUALS 1?…

A: Erwin Chargaff proposed two rules which are termed as Chargaff's rule. These rules played an…

Q: Identify the solution component that contains the extracted DNA.

A: Ethanol precipitation method is generally used for DNA extraction.

Q: Which one of the following options would be a good way to identify the location of the poly A tail…

A: Pre mRNA undergoes several post-transcriptional modifications. One of these modifications is…

Q: The sequence below shows one strand of DNA. Parts of the sequence are in capital letters to help you…

A: Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…

Q: Draw a 4-N base strand of DNA with all four N-base sequences represented

A: Introduction :  Deoxyribonucleic acid, or DNA, is the genetic material found in humans and the…

Q: Given the DNA template strand 3' GCATTCAAG 5', write the amino acid sequence in the N‑terminal to…

A: Amino acids are the basic units (monomers) that makeup proteins. They consolidate to frame short…

Q: Draw a generalized nucleotide. Just put “base” instead of drawing the actual base. Label the carbons…

A: Nucleotides are the monomer units of biological polymers nucleic acids (DNA and RNA). They composed…

Q: Given the banding pattern from the gel electrophoresis below, the nucleotide sequence of this…

A: Gel-electrophoresis:- it is a technique used for the separation of charged molecules such as DNA,…

Q: How many different reading frames are possible in a stretch of double-stranded DNA?

A: Introduction -open reading frame = • In molecular genetics, an open reading frame (ORF) is the part…

Q: If you worked backward, starting with the amino acid sequence of the protein, would you obtain the…

A: The fundamental tenet of molecular biology is the idea that genetic material can only move from DNA…

Q: explain why the order is 3–1-4-2 and not another way, thank you so much

A: Shotgun sequencing It is a method used in laboratories to identify the DNA sequence of a genome. The…

Q: A DNA fragment with the following base sequence has some cytosine bases that are methylated…

A: The bisulfate sequencing is the treatment of DAN with bisulfite before the routine sequencing for…

Q: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5'    Q:  Based on written…

A: The DNA has two strands one is the Template strand and other is the coding strand. Based on the…

Q: What are the kinds of unusual structures of DNA you are aware of? List at least four examples.…

A: DNA does not always take the form of a double helix. It can often be found creating structures…