An investigator has a strand of chromosomal DNA whose sequence is shown. She wants to use polymerase chain reaction (PCR)to amplify and isolate the DNA fragment defined by the highlighted segment. Her first step is to design two PCR primers, each20 nucleotides long, that can be used to amplify this DNA segment. The final PCR product generated from the primers shouldinclude no sequences outside of the highlighted segment.5'---AATGCCTCAGCCGATCTGCCTCGAGTCAATCGATGCTGGTAACTTGGGGTATAAAGCTTACCCATGGTATCGTAGTTAGATTGATTGTTAGGTTCTTAGGTTTAGGTTCTGGTATTGGTTTAGGGTCTTTGATGCTATTAATTCTTTGGTTTTGATTTGGTCTTTATATGGTTTATGTTTTAAGCCGGGTTTTGTCTGG-GATGGTTCGTCTGATGTGCGCGTAGCGTGCGGCG---3'What are the sequences of the investigator's forward and reverse primer? Enter them 5' to 3'.forward primer:reverse primer:GGAGCTCAGTTAGCTACGACIncorrectCGCCGCACGCTA-Incorrect

PCR or polymerase chain reaction is a lab procedure that amplified fragments of DNA by using a thermostable DNA polymerase. The reaction mixture requires four main components: a template strand (the strand that needs to be amplified), the four dNTPs, thermostable DNA polymerase and a primer( short sequence of nucleotides that provides 3'-OH for polymerase to add new nucleotide to). Primers are suppose to be 20 nucleotide long minimum and ideally should start and end with with a GC pair because the GC pairing involves three hydrogen bonding and ensure primer annealing. Forward primer in technical terms is complementary to the 3' end of the anti-sense strand; that is, it binds to the 3' end of the complementary strand of the given DNA sequence. Given to us is the sense strand. So foward primer shoud be, considering that only highlighted sequence be included in the PCR product: 5'-GGTCGTAGCTAACTGAGCTCC-3' Reverse primer in technical terms is complementary to the 3' end of the sense strand; that is, it binds to the 3' end of the given DNA strand. So reverse primer shoud be, considering that only highlighted sequence be included in the PCR product: 5'-CGCGCACATCACGAACCATC-3'