Answered: . (a) Which codon is the start codon in…

. (a) Which codon is the start codon in the mRNA below? mRNA 5 - AAUAUGCGGAUGCCCGAA -3 AAU UUA AUG UAG (b) There is an addition of Adenine in the mRNA sequence specifically at AUG codon.

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: codons are part of the molecular structure of

Q: Question 10 Review mutations. Match the term and its description. Each term can only be used once.…

A: change in just one nucleotide pair is called a point mutation the mutation that does not have an…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine, The possible codons can be CCG CGC GCC GGC GCG CGG

Q: The "factory" itself, made of two [Choose] subunits [Choose] FRNA The site from which the growing…

A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: Mutated DNA Sequence #3 T A C A C C T TAG C GACGACT... What's the mRNA sequence? (Circle the change)…

A: DNA sequencing is the process of determining the nucleic acid sequence in the order of the…

Q: کو اتار کر کے TATAAA box Translation initiation codon Intron 1 Exon 2 Intron 2 A. 5' Capping defect…

A: The answer is option The answer is option (E). Protein truncation.

Q: 1 5'- TATATACTGT ATGGTGGGTT GATCTATGTA TCAACAGTAC GGCTCGCAGG TACCCGATGA GATGGGAAGG TGGGTTGACA…

A: Introduction : The genetic code is a system of rules that living cells use to interpret the…

Q: a. Which amino acid does this code for? [Select] dentify the effect of the following point mutations…

A: Introduction Mutation is a sudden heritable change in our DNA or genetic material. Mutation can…

Q: What codon results in a release factor entering the ribosome? 5' M GPPP-…

A: Translation is a process of formation of protein from mRNA. This process takes place in the…

Q: 1. What mRNA sequence does the following DNA template sequence produce? DNA…

A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…

Q: #7

A: There are different types of mutations, that result in a change or no change in the protein…

Q: 3. Using your Genetic Code, translate and group the following MRNA bases. Example: UAC CAG UGG UUU…

A: a. 5 'CUC GGU ACG UAA UAG AUC UAU CAU CCG AGA CUC UUA AAU 3' ANSWER: 5' Leu Gly Thr Stop Stop Ile…

Q: Part A Which of the following processes is represented in the figure below? 3' AAG UGA RF1 RF2 O…

A: Thank you for the question Answer :- The given picture shows translation termination Explanation :-…

Q: Is this diagram of tRNA technically incorrect? Shouldn't it be 3' on the left and 5' on the right…

A: The tRNA or the transfer acyl Ribonucleic Acid serves as an adapter molecule during the process of…

Q: Which of the following mutations would cause translation to end? O Mutation 1 O Mutation 2 Mutation…

A: Translation is the process where protein gets form. Here the start codon is AUG and the estoppel…

Q: A point mutation within a codon that does not change the resulting amino acid sequence is known as…

A: Mutation is a change of nucleotide sequence of DNA. When there is a change in single nucleotide of…

Q: I keep getting this maked wrong, if you distinguish my mistake and explain to me in a deeper…

A: The translation is the process by which the genetic code encrypted in the mRNA gets converted to…

Q: Complete the labels for the following diagram of translation. NOTE: A is the product of this…

A: Translation is the second step of gene expression in which information from mRNA is encoded into the…

Q: True or False. tRNA anticodons are antiparallel and complimentary in nucleotide sequence to their…

A: Transcription of eukaryotic genes does not give us a mature RNA but often a pre-RNA that requires…

Q: 11. Determine the genetic codes for the following sequence of 3 amino acids: Asn-Glu-Ly a. Provide…

A: Amino acids are organic compounds made up of carbon, hydrogen, oxygen and nitrogen atoms. They are…

Q: What is the sequence of the peptide that would result following translation with a ribosome?…

A: Translation is the process in which the mRNA is converted into a long chain of polypeptide called…

Q: . By inspecting Table 4.5, discuss how the genetic code has evolved to help minimize the impact of…

A: A genetic code is a set of three nucleotide bases that is used to translate information encoded in…

Q: Which mRNA modification is likely absent if the mRNA is degrading prematurely from the 5’ end of the…

Q: What will be the anticodon of the next tRNA added to the A site of the ribosome?

A: Codons are situated in on mRNA and anticodons are situated on tRNA.

Q: 29. Translation ends when O a release factor causes the translation complex to dissociate TRNA…

A: Translation is the process of formation of a polypeptide chain from an mRNA transcript. It occurs…

Q: 21. mRNA serves as template for the synthesis of polypeptide. true or false

A: The translation process is by which organisms forms protein or a polypeptide chain.

Q: If the first G changes to A what kind of mutation will happen? Show the change in amino acid…

A: When there is an error in the DNA sequence during replication it causes a change in the DNA…

Q: 25. A portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a…

A: The translation is a process of Protein synthesis where a copy of mRNA is used as a template strand.…

Q: START CODON STOP CODON 3' MRNA 5' UGAUCAU GAUCUCGUAAGAUAUC Met Ile Ser) STOP Polypeptide 1. Why do…

A: DNA is the genetic material that is present in almost all the organisms except for the viruses that…

Q: Consider an image of an mRNA being translated. fMet Pro HAUG COCACG

A: In biology, "translation" refers to the second stage of protein synthesis, which is the process by…

Q: 43/ 50 Which of the following molecular structures contan codons? A a protein B mRNA CIRNA DIRNA EB…

A: Introduction :- A codon is a three-nucleotide DNA or RNA sequence that serves as a unit of genomic…

Q: What anticodon would a suppressor tRNA have to have to suppress a 5'UAA3' stop codon?

A: A mutation in the gene that changes its anticodon loop for a tRNA molecule can "suppress" nonsense…

Q: Now imagine that a mutation occurred in the g of the codon below and the G became a C. How would…

A: a mutation occurred in the g of the codon below and the G became a C A T G Changes to A T C…

Q: What is the last codon in this mRNA sequence? AUGCCAUGG

A: mRNA is synthesized from DNA ,this process is known as transcription.

Q: SARS E You have generated several random mutations in this region. One of them is -…

A: DNA -> Transcription -> mRNA -> Translation -> ProteinTranscription is the synthesis of…

Q: Finally, imagine that a mutation occurred in the codon below and an A was inserted between the two…

A: a mutation occurred in the codon below and an A was inserted between the two Ts T T G chnages to T…

Q: below is a prokaryotic mRNA transcript and the polypeptide that results as this transcript is…

A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum create…

Q: Describe how a mutation can occur using the image shown

A: A nucleotide is an organic molecule that serves as the foundation for DNA and RNA. They also play…

Q: 1. (a)How many amino acids are found in the polypeptide when the mRNA is translated? mRNA 5 -…

A: The protein is synthesized by the translation process. It takes place in the cytoplasm.

Q: In Figure 9-17, what do you think happens next to theribosomal subunits after they are finished…

A: To form a particular amino acid chain, or polypeptide, messenger RNA (mRNA) is decoded in a ribosome…

Q: The eukaryotic mature mRNA sequence will be translated into a polypeptide that is _____ amino acids…

A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…

Question

100%

1. (a)

Which codon is the start codon in the mRNA below? mRNA 5 - AAUAUGCGGAUGCCCGAA -3

		AAU
		UUA
		AUG
		UAG

(b)

There is an addition of Adenine in the mRNA sequence specifically at AUG codon.

		missense mutation
		nonsense mutation
		silent mutation
		frameshift mutation

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

36.Start with two exons and an intervening intron. Include the cap and poly-A tail in your starting pre-mRNA. Show 2’-OH, 3’-OH, O-P-O phosphodiester bonds for the two transesterification reactions that splice exon 1 and exon 2. Be sure to include the branchpoint A and intron consensus sequences. You will need to show where the incoming -OH attacks the O-P-O bond to allow correct splicing in the lariat and between exons. Make your arrows precise. Show the lariat with the consensus sequences. Whenever possible, show 5’ and 3’ ends. Explain the fate of the lariat after it forms?
37. A portion of an mRNA attached to a ribosome reads: 5′ UUUGACCCCACG 3′ If a tRNA with an aspartic acid amino acid attached is in the P site of the ribosome, a tRNA with which amino acid attached will enter the A site? What amino acid will be attached to the amino group of the histidine encoded by this mRNA?
mRNA sequence of A gene Find start codon and stop codon 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCCUACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACGACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGCUGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGAGGUAGAAGCCGCUGGGGCUUGGGGCU-3’
5
What is the importance of the anticodon on the tRNA?
Now imagine that a mutation occurred in the second T of the codon below and the T became a G. How would this affect the mRNA and the amino acid for that codon? Old DNA codon Old RNA codon Old amino acid New DNA codon New mRNA codon New amino acid T T G T G G This would be an example of which type of a point mutation?__________________________
Can you explain it?
How did they get N-Met-Ser-Gly-C?
2. please answer this asap
16S sequence information will be composed of: As and Us and Cs and Gs that make the mRNA sequence dn As and Ts and Cs and Gs that make up the DNA sequence amino acids that build the ribosome amino acid codons that make up the mRNA small enzymes that build the ribosome
WOULD YOU HELPS ME
SA p PDF as trasc d PDF During the translation of an mRNA segment, different activated tRNAs (aatRNAs)-specified here by their anticodons written 3' to 5' bind through hydrogen bonds to mRNA in subscripts-successively codons in the following order: Teas fill PDF Cave UNOFFIC aatRNAGAA binds, then aatRNACAC, then aatRNAUUG, then aatRNAGUU, then aatRNAGUG, then aatRNAGAC What would the sequence of that mRNA segment be? O GAA CAC UUG GUU GUG GAC O CUU GUG AAC CAA CAC CUG O CTT GTG AAC CAA CAC CTG O Glu-His-Leu-Val-Val-Asp hu O Search PD maste omiss