Biology: Life on Earth with Physiology (11th Edition)
11th Edition
ISBN: 9780133923001
Author: Gerald Audesirk, Teresa Audesirk, Bruce E. Byers
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 9.4, Problem 1CSC
Body, Heal Thyself
Ligaments and tendons have a limited capacity for self-repair. They tend to have a meager blood supply and contain only a small number of specialized cells that produce proteins, such as collagen and elastic, that provide flexibility and strength. In Bartolo Colón’s case, the hope was that the stem cells injected into his shoulder and elbow would progress rapidly through the cell cycle, producing large populations of specialized daughter cells that would regenerate his ligaments and tendons. How would mitotic cell division ensure that the daughter cells contained accurate copies of all of Colón’s chromosomes, including the genes that specify all of the proteins needed to repair his arm?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 9 Solutions
Biology: Life on Earth with Physiology (11th Edition)
Ch. 9.1 - describe the types of cells found in a...Ch. 9.1 - describe the functions of cell division in...Ch. 9.2 - describe the prokaryotic cell cycle and the major...Ch. 9.3 - describe the structure of a eukaryotic chromosome?Ch. 9.3 - describe the functions of telomeres and...Ch. 9.4 - Body, Heal Thyself Ligaments and tendons have a...Ch. 9.4 - describe the events of the eukaryotic cell cycle?Ch. 9.4 - explain the difference between mitotic cell...Ch. 9.5 - Body, Heal Thyself The precision of mitotic cell...Ch. 9.5 - describe the steps of mitotic cell division?
Ch. 9.5 - What would the consequences be if one set of...Ch. 9.5 - describe the usual outcome of mitotic cell...Ch. 9.5 - Prob. 3CYLCh. 9.6 - Body, Heal Thyself Bartolo Colns physicians wanted...Ch. 9.6 - Prob. 1CTCh. 9.6 - describe the interactions among growth factors,...Ch. 9.6 - Yesterday, when Daniel was showering after a...Ch. 9.6 - The saliva of dogs, like the saliva of most...Ch. 9.6 - What would happen if a cell suffered a mutation...Ch. 9.6 - explain how a cell protects against producing...Ch. 9 - Most nerve cells in the adult human central...Ch. 9 - The genetic material of all living organisms is...Ch. 9 - A cell that remains capable of dividing throughout...Ch. 9 - Diagram and describe the eukaryotic cell cycle....Ch. 9 - Prob. 2ACCh. 9 - Prokaryotic cells divide by a process called...Ch. 9 - Prob. 2MCCh. 9 - Prob. 2RQCh. 9 - Prob. 3FIBCh. 9 - Prob. 3MCCh. 9 - Prob. 3RQCh. 9 - Prob. 4FIBCh. 9 - How does prokaryotic fission differ from...Ch. 9 - Define the following terms: centromere, telomere,...Ch. 9 - The four phases of mitosis are _________,...Ch. 9 - Prob. 5MCCh. 9 - Prob. 5RQCh. 9 - Prob. 6FIBCh. 9 - Prob. 6RQCh. 9 - Prob. 7RQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
TISSUE REPAIR Part 1: Repair - Regeneration; Author: ilovepathology;https://www.youtube.com/watch?v=t-5EjlS6qjk;License: Standard YouTube License, CC-BY