Microbiology: A Systems Approach
4th Edition
ISBN: 9780073402437
Author: Marjorie Kelly Cowan Professor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 9.2, Problem 10AYP
Summary Introduction
To define:
The term codon and anticodon and also list four known start and stop codon.
Introduction:
Codon is defined as the
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Define the terms codon and anticodon, and list three start and stop codons.
The anticodon for the codon GCA is:
For each codon, provide the anticodon and the three-letter abbreviation of the amino acid for which it codes. Consult the codon
table as needed.
5'-AUU-3'
anticodon: 3'-
-5'
amino acid:
5' -UCU-3'
anticodon: 3'-
-5'
amino acid:
5' -CAG-3'
anticodon: 3'-
-5'
amino acid:
Chapter 9 Solutions
Microbiology: A Systems Approach
Ch. 9.1 - Define the terms genome and gene.Ch. 9.1 - Differentiate between genotype and phenotype.Ch. 9.1 - Diagram a segment of DNA, labeling all important...Ch. 9.1 - Summarize the steps of bacterial DNA replication...Ch. 9.1 - Compare and contrast the synthesis of leading and...Ch. 9.2 - Explain how the classical view of the central...Ch. 9.2 - Prob. 7AYPCh. 9.2 - Illustrate the steps of transcription, noting the...Ch. 9.2 - Prob. 9AYPCh. 9.2 - Prob. 10AYP
Ch. 9.2 - Identify the locations of the promoter, the start...Ch. 9.2 - Prob. 12AYPCh. 9.2 - Prob. 13AYPCh. 9.3 - Define the term operon and explain one advantage...Ch. 9.3 - Differentiate between repressive and inducible...Ch. 9.3 - Prob. 16AYPCh. 9.4 - Explain the defining characteristics of a...Ch. 9.4 - Describe three forms of horizontal gene transfer...Ch. 9.5 - Prob. 19AYPCh. 9.5 - Prob. 20AYPCh. 9 - Prob. 1CFCh. 9 - What is the smallest unit of heredity? a....Ch. 9 - The nitrogen bases in DNA are bonded to the a....Ch. 9 - DNA replication is semiconservative because the...Ch. 9 - In DNA, adenine is the complementary base for...Ch. 9 - Transfer RNA is the molecule that a. contributes...Ch. 9 - Prob. 6MCQCh. 9 - The lac operon is usually in the _____ position...Ch. 9 - Prob. 8MCQCh. 9 - Prob. 9MCQCh. 9 - When genes are turned on differently under...Ch. 9 - The DNA pairs are held together primarily by...Ch. 9 - Prob. 12TFCh. 9 - Prob. 13TFCh. 9 - Prob. 14TFCh. 9 - Prob. 15TFCh. 9 - Explain the relationship among the following...Ch. 9 - Prob. 2CTQCh. 9 - On paper, replicate the following segment of DNA:...Ch. 9 - Provide evidence in support of or refuting the...Ch. 9 - Prob. 5CTQCh. 9 - Prob. 6CTQCh. 9 - Prob. 7CTQCh. 9 - Prob. 8CTQCh. 9 - Prob. 9CTQCh. 9 - Use your knowledge of DNA recombination events to...Ch. 9 - Prob. 1CCCh. 9 - Prob. 2CCCh. 9 - Prob. 3CCCh. 9 - Prob. 1VCCh. 9 - From chapter 4, figure 4.11a. Speculate on why...Ch. 9 - Concept Mapping | Blooms Level 6: Create Appendix...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Define the mutations of the second base of triplet codons ?arrow_forwardHow many codons are possible for an RNA trinucleotide having an adenine base, a cytosine base, and guanine base?arrow_forwardList all possible codons present in a ribonucleotide polymer containing U and G in random sequence. Which amino acids are encoded by this RNA?arrow_forward
- What codons are used and with what frequency?arrow_forwardCodons in the set CUU, CUC, CUA, and CUG all code for the amino acid leucine. In this set, the first and second bases are identical; the identity of the third base is irrelevant. For what other sets of codons is the third base also irrelevant? For what amino acid(s) does each set code?arrow_forwardThe amino acid glycine is encoded by four codons: GGA, GGC, GGG, and GGU. Which of the following statements correctly explains this fact? The glycine anticodon contains the sequence CC, but the 5' base of the anticodon can pair nonspecifically with the 3' base of the codon. The glycine anticodon contains the sequence CC, but the 3' base of the anticodon can pair nonspecifically with the 5' base of the codon. Glycine tRNA has four anticodons, and the appropriate anticodon specifically pairs with the correct codon. There are four tRNAs for glycine, each of which has an anticodon that specifically pairs with the correct codon. all of the abovearrow_forward
- Codons 24 to 66 represent an intron. At what point in the process of protein synthesis are introns removed? What is the name of the enzyme responsible for removing them?arrow_forwardIndicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’arrow_forwardA gene contains 141 codons. How many nucleotides are present in the gene’s coding sequence? How many amino acids are expected to be present in the polypeptide encoded by this gene?arrow_forward
- What could be the effect of a deletion, substitution or addition that alters the sequence of the stop codons?arrow_forwardCompare the codons with a pyrimidine, either U or C, as the second base. Do the majority of the amino acids specified by these codons have hydrophobic or hydrophilic side chains?arrow_forwardTranslate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning