Microbiology: A Systems Approach
4th Edition
ISBN: 9780073402437
Author: Marjorie Kelly Cowan Professor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 9, Problem 10CTQ
Use your knowledge of DNA recombination events to complete the following:
- a. Propose two ways in which antibiotic resistance may develop in a bacterium.
- b. Explain how transposable elements may be used to treat humans with mutations in insulin-producing genes.
- c. Describe how bacterial cells acquire the ability to produce toxins.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
In a process of production of a recombinant protein by E. coli cells, it was observed accumulation of acetate in the culture medium. In this situation, it can be said that:
(a) certainly the process in question was being conducted in anaerobiosis
(B).Acetate accumulation is advantageous for the process as the acetate formation reaction generates 1 molecule of ATP
(c)Knowing that decreasing the temperature of the process causes a reduction in the rate of glycolysis, this could be a strategy to reduce the accumulation of acetate
(d).the acetate formed can be re-assimilated by the cell if the glyoxylate pathway is activated at some point in the culture
A research group is studying a bacterium X that binds to mucosal cells in the lung and invades. Wildtype X has an LD50 value of 10 bacteria when administered to mice by inhalation. Using transposon mutagenesis, the researchers have isolated two mutants of X that they call Xmut1 and Xmut2, both of which have LD50 values of 105 when inhaled by mice. However, in tissue culture cells, Xmut1 can invade the cells just as well as wild-type X, while Xmut2 cannot. Provide a possible explanation for these results.
Several common antibiotics affect some strains of bacteria's ability to carry out transcription and/or translation. For example:
Rifamycin inhibits prokaryotic RNA polymerase
Chloramphenicol blocks the transfer of the peptide from the P to A site.
a) For each of these drugs, identify at what point it could affect the process of DNA->RNA->protein. Be as specific as possible.
b) Why do you think these drugs kill bacteria but spare animal cells? (Hint: remember bacteria are prokaryotes)
Chapter 9 Solutions
Microbiology: A Systems Approach
Ch. 9.1 - Define the terms genome and gene.Ch. 9.1 - Differentiate between genotype and phenotype.Ch. 9.1 - Diagram a segment of DNA, labeling all important...Ch. 9.1 - Summarize the steps of bacterial DNA replication...Ch. 9.1 - Compare and contrast the synthesis of leading and...Ch. 9.2 - Explain how the classical view of the central...Ch. 9.2 - Prob. 7AYPCh. 9.2 - Illustrate the steps of transcription, noting the...Ch. 9.2 - Prob. 9AYPCh. 9.2 - Prob. 10AYP
Ch. 9.2 - Identify the locations of the promoter, the start...Ch. 9.2 - Prob. 12AYPCh. 9.2 - Prob. 13AYPCh. 9.3 - Define the term operon and explain one advantage...Ch. 9.3 - Differentiate between repressive and inducible...Ch. 9.3 - Prob. 16AYPCh. 9.4 - Explain the defining characteristics of a...Ch. 9.4 - Describe three forms of horizontal gene transfer...Ch. 9.5 - Prob. 19AYPCh. 9.5 - Prob. 20AYPCh. 9 - Prob. 1CFCh. 9 - What is the smallest unit of heredity? a....Ch. 9 - The nitrogen bases in DNA are bonded to the a....Ch. 9 - DNA replication is semiconservative because the...Ch. 9 - In DNA, adenine is the complementary base for...Ch. 9 - Transfer RNA is the molecule that a. contributes...Ch. 9 - Prob. 6MCQCh. 9 - The lac operon is usually in the _____ position...Ch. 9 - Prob. 8MCQCh. 9 - Prob. 9MCQCh. 9 - When genes are turned on differently under...Ch. 9 - The DNA pairs are held together primarily by...Ch. 9 - Prob. 12TFCh. 9 - Prob. 13TFCh. 9 - Prob. 14TFCh. 9 - Prob. 15TFCh. 9 - Explain the relationship among the following...Ch. 9 - Prob. 2CTQCh. 9 - On paper, replicate the following segment of DNA:...Ch. 9 - Provide evidence in support of or refuting the...Ch. 9 - Prob. 5CTQCh. 9 - Prob. 6CTQCh. 9 - Prob. 7CTQCh. 9 - Prob. 8CTQCh. 9 - Prob. 9CTQCh. 9 - Use your knowledge of DNA recombination events to...Ch. 9 - Prob. 1CCCh. 9 - Prob. 2CCCh. 9 - Prob. 3CCCh. 9 - Prob. 1VCCh. 9 - From chapter 4, figure 4.11a. Speculate on why...Ch. 9 - Concept Mapping | Blooms Level 6: Create Appendix...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Order the following experimental steps to identify auxotrophic mutants in Saccharomyces Cerevisiae that cannot sythesize their own Leucine. an option can be selected more than once. step 1: Step 2: Step 3: Step 4: Step 5: Step 6:arrow_forwardIt is desired to isolate genomic DNA from liquid culture of S. cerevisiae yeast. A commercial kit will be used to isolate genomic DNA from this liquid culture. Answer the following questions to understand the strategy used by commercial kits for genomic DNA isolation. a) List all the steps from cell pellet preparation to DNA elution. b) With which feature can the membrane in the column that comes with the commercial kit bind DNA? c) Which component in the kit would you use to recover the DNA from the membrane of the column to which the DNA was attached?arrow_forwardIdentify the most mistaken (wrong) choice: a) Transcription machinery and an enhancer can bind to the chromosome at the same time. b) Organic matters may interfere with heat treatment of bacterial growth control. ( c) Nitrocellulose can be used to filter out microorganisms from a liquid solution. d) Time to kill a bacterial culture is not proportional to the number of microbes in the culturearrow_forward
- With respect to recombinant vaccines, it is CORRECT to state that: * (Only one statement is correct) (a) Protein subunit vaccines are formulated with the expression vector encoding the immunogenic protein or protein fragment (b) Recombinant carrier organisms are genetically modified to contain the pathogenic protein of the organism that will be the target of the vaccine (c) Nucleic acid vaccines are formulated with DNA or RNA molecules that, once internalized by cells, will generate recombinant proteins that will trigger the immune response against the desired pathogen (d) Unlike DNA vaccines, mRNA vaccines do not need to be internalized by cells, being recognized as foreign molecules to the organism that received them. (e) Laboratory-produced phages can be used as delivery tools in DNA vaccines, which will allow the expression of immunogenic proteins to the organism that received them (f) Pseudoviral particles (VLPs) are produced in cells that receive expression vectors…arrow_forwardBriefly describe the effects of colchicine treatment on cells. What are the genetic implications of such effects?arrow_forwardIf the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individualarrow_forward
- Consider the following experiment. First, large populations of two mutant strains of Escherichia coli are mixed, each requiring a different, single amino acid. After plating them onto a minimal medium, 45 colonies grew. Which of the following may explain this result? A) The colonies may be due to back mutation (reversion). B) The colonies may be due to recombination. C) Either A or B is possible. D) Neither A nor B is possible.arrow_forwardExplain how site directed mutagenesis can be accomplished using M13 bacteriophage. Using this method often results in only 5% of plaques with mutant gene. Explain how the procedure has been modified to enrich for the number of plaques with the mutant gene.arrow_forwardYou have a leu auxotroph strain of e. coli. You suspect that if you mutagenize this strain, you can isolate prototrophic revertants. You irradiate these cells to generate mutants. A) What media should you plate these mutants on to identify leu prototrophs? answers: a. minimal media + carbon source b. minimal media - leu c. rich media d. rich media + ampicillin e. rich media -trparrow_forward
- You are investigating the activity of different cadherins in cells. You use recombinant DNA technology to express GFP-E-cadherin (green) in some L-cells (which do not normally contain cadherin) and YFP-P-cadherin (yellow) in other L-cells. Explain results you expect in three cultures containing: (1) only cells expressing GFP-E-cadherin, (2) only cells expressing YFP-P-cadherin, and (3) a mixture of GFP-E-cadherin-expressing and YFP-P-cadherin-expressing cells. Also predict how (a) knocking down the ability of the cells to synthesize fibronectin (FN) or (b) adding EGTA, which depletes free Ca2+ concentration in the culture medium, might affect the results.arrow_forwardRegarding the cultivation of animal cells in vitro, it is correct to state that: *(Only one statement is correct) a) Transformed cells differ from normal and established cells in that they have the ability to proliferate indefinitely in culture b) Transformed cells derive from isolated and dissected tumors, constituting cell lines that have limited cultivation time c) The genetic instability presented in normal cells makes them preferential models for the production of recombinant proteins d) Cells cultured in adhesion must be periodically expanded, through the use of enzymes such as trypsin e) The metabolism of carbon sources in the culture medium by animal cells generates products such as lactate, which positively influence their productivityarrow_forwardXeroderma pigmentosum is a genetic disease caused by an error in the nucleotide excision repair process that fixes damage to DNA by ultraviolet light. Studies have shown that it can result from mutations in any one of seven genes. What can you infer from this finding? A) There are seven genes that produce the same protein B) These seven genes are the most easily damaged by ultraviolet light. C) There are seven enzymes involved in the nucleotide excision repair process. D) These mutations have resulted from translocation of gene segments.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license