
Human Anatomy
5th Edition
ISBN: 9780073403700
Author: Kenneth S. Saladin Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Question
Chapter 9.1, Problem 1AWYK
Summary Introduction
To determine:
The classification of the intervertebral joints of the sacrum and coccyx in an adult when it's given that the intervertebral discs in the cervical to the lumbar region are symphyses.
Introduction:
The vertebral column describes the sequential arrangement of 33 vertebral bones. The other common names of the vertebral columns are backbone and spine. It is a characteristic feature in the classification of animalia phylum.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 9 Solutions
Human Anatomy
Ch. 9.1 - Prob. 1AWYKCh. 9.1 - Prob. 1BYGOCh. 9.1 - Prob. 2BYGOCh. 9.1 - Give some examples of joints that become...Ch. 9.1 - Prob. 4BYGOCh. 9.1 - Prob. 5BYGOCh. 9.1 - Prob. 6BYGOCh. 9.2 - Prob. 1AWYKCh. 9.2 - Prob. 2AWYKCh. 9.2 - What are the two components of a joint capsule?...
Ch. 9.2 - Give at least one example each of a monaxial,...Ch. 9.2 - Prob. 9BYGOCh. 9.3 - Where else in the body is there a structure...Ch. 9.3 - Prob. 10BYGOCh. 9.3 - Prob. 11BYGOCh. 9.3 - What keeps the femur from slipping backward off...Ch. 9.3 - Prob. 13BYGOCh. 9.4 - Define arthritis. How do the causes of...Ch. 9.4 - Prob. 15BYGOCh. 9 - Prob. 9.1.1AYLOCh. 9 - Prob. 9.1.2AYLOCh. 9 - Prob. 9.1.3AYLOCh. 9 - Prob. 9.1.4AYLOCh. 9 - Prob. 9.1.5AYLOCh. 9 - Prob. 9.1.6AYLOCh. 9 - Prob. 9.1.7AYLOCh. 9 - Prob. 9.2.1AYLOCh. 9 - Prob. 9.2.2AYLOCh. 9 - Prob. 9.2.3AYLOCh. 9 - Prob. 9.2.4AYLOCh. 9 - Prob. 9.2.5AYLOCh. 9 - Prob. 9.2.6AYLOCh. 9 - Prob. 9.2.7AYLOCh. 9 - Prob. 9.2.8AYLOCh. 9 - The same for elevation and drpessionCh. 9 - Prob. 9.2.10AYLOCh. 9 - Prob. 9.2.11AYLOCh. 9 - Prob. 9.2.12AYLOCh. 9 - Prob. 9.2.13AYLOCh. 9 - Prob. 9.2.14AYLOCh. 9 - The same for rotation of the head or torsoCh. 9 - The same for lateral and medial excursion of the...Ch. 9 - Prob. 9.2.17AYLOCh. 9 - Prob. 9.2.18AYLOCh. 9 - The same for the ankle or foot movements of...Ch. 9 - Prob. 9.2.20AYLOCh. 9 - Prob. 9.3.1AYLOCh. 9 - Prob. 9.3.2AYLOCh. 9 - Prob. 9.3.3AYLOCh. 9 - Prob. 9.3.4AYLOCh. 9 - Special functional qualities of the tibiofemoral...Ch. 9 - Prob. 9.3.6AYLOCh. 9 - The range of discorders included in the concept of...Ch. 9 - The general meaning of arthritis, and the...Ch. 9 - Prob. 9.4.3AYLOCh. 9 - Prob. 1TYRCh. 9 - Which of the following is the least movable? a...Ch. 9 - Prob. 3TYRCh. 9 - Prob. 4TYRCh. 9 - Prob. 5TYRCh. 9 - Prob. 6TYRCh. 9 - Prob. 7TYRCh. 9 - Prob. 8TYRCh. 9 - To bend backward at the waist involves ________ of...Ch. 9 - Prob. 10TYRCh. 9 - Th lubricant of a diarthrosis is _________.Ch. 9 - Prob. 12TYRCh. 9 - Prob. 13TYRCh. 9 - Prob. 14TYRCh. 9 - Prob. 15TYRCh. 9 - Prob. 16TYRCh. 9 - Prob. 17TYRCh. 9 - Prob. 18TYRCh. 9 - Prob. 19TYRCh. 9 - Prob. 20TYRCh. 9 - Prob. 1BYMVCh. 9 - Prob. 2BYMVCh. 9 - Prob. 3BYMVCh. 9 - Prob. 4BYMVCh. 9 - Prob. 5BYMVCh. 9 - Prob. 6BYMVCh. 9 - Prob. 7BYMVCh. 9 - Prob. 8BYMVCh. 9 - Prob. 9BYMVCh. 9 - State a meaning of each word element and give a...Ch. 9 - Prob. 1TOFCh. 9 - Prob. 2TOFCh. 9 - Prob. 3TOFCh. 9 - Determine which five of the following statements...Ch. 9 - Prob. 5TOFCh. 9 - Prob. 6TOFCh. 9 - Prob. 7TOFCh. 9 - Prob. 8TOFCh. 9 - Prob. 9TOFCh. 9 - Prob. 10TOFCh. 9 - Prob. 1TYCCh. 9 - Prob. 2TYCCh. 9 - In order of occurrence, list the joint actions...Ch. 9 - Prob. 4TYCCh. 9 - Prob. 5TYC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage LearningBasic Clinical Lab Competencies for Respiratory C...NursingISBN:9781285244662Author:WhitePublisher:CengageAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College
- Fundamentals of Sectional Anatomy: An Imaging App...BiologyISBN:9781133960867Author:Denise L. LazoPublisher:Cengage Learning

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
Basic Clinical Lab Competencies for Respiratory C...
Nursing
ISBN:9781285244662
Author:White
Publisher:Cengage

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Fundamentals of Sectional Anatomy: An Imaging App...
Biology
ISBN:9781133960867
Author:Denise L. Lazo
Publisher:Cengage Learning
The Skeletal System; Author: Professor Dave Explains;https://www.youtube.com/watch?v=f-FF7Qigd3U;License: Standard YouTube License, CC-BY