The genes present on the chromosomes have alleles. They define the phenotypic and genotypic traits of the person. The types of alleles include dominant and recessive condition, which are depicted by a capital letter and a small letter for, example B for a dominant allele and b for a recessive allele of a gene. The combination of both the genes after recombination defines the phenotype or the external expression of the characters of a particular person. The dominant allele of a gene expresses to form a protein, whereas the recessive allele does not express and is not involved in the phenotypic expression of the characters of a person. The recessive allele is expressed only in the homozygous recessive state, when the genes for the dominant phenotype are not present.

Question

Want to see the full answer?

Answer 1

Question

Chapter 9, Problem 4SQ

Summary Introduction

Introduction: The genes present on the chromosomes have alleles. They define the phenotypic and genotypic traits of the person. The types of alleles include dominant and recessive condition, which are depicted by a capital letter and a small letter for, example B for a dominant allele and b for a recessive allele of a gene. The combination of both the genes after recombination defines the phenotype or the external expression of the characters of a particular person. The dominant allele of a gene expresses to form a protein, whereas the recessive allele does not express and is not involved in the phenotypic expression of the characters of a person. The recessive allele is expressed only in the homozygous recessive state, when the genes for the dominant phenotype are not present.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?

Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks

Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?

Answer 2

Question

Chapter 9, Problem 4SQ

Summary Introduction

Introduction: The genes present on the chromosomes have alleles. They define the phenotypic and genotypic traits of the person. The types of alleles include dominant and recessive condition, which are depicted by a capital letter and a small letter for, example B for a dominant allele and b for a recessive allele of a gene. The combination of both the genes after recombination defines the phenotype or the external expression of the characters of a particular person. The dominant allele of a gene expresses to form a protein, whereas the recessive allele does not express and is not involved in the phenotypic expression of the characters of a person. The recessive allele is expressed only in the homozygous recessive state, when the genes for the dominant phenotype are not present.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 9, Problem 4SQ

Summary Introduction

Introduction: The genes present on the chromosomes have alleles. They define the phenotypic and genotypic traits of the person. The types of alleles include dominant and recessive condition, which are depicted by a capital letter and a small letter for, example B for a dominant allele and b for a recessive allele of a gene. The combination of both the genes after recombination defines the phenotype or the external expression of the characters of a particular person. The dominant allele of a gene expresses to form a protein, whereas the recessive allele does not express and is not involved in the phenotypic expression of the characters of a person. The recessive allele is expressed only in the homozygous recessive state, when the genes for the dominant phenotype are not present.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 9, Problem 4SQ

Summary Introduction

Introduction: The genes present on the chromosomes have alleles. They define the phenotypic and genotypic traits of the person. The types of alleles include dominant and recessive condition, which are depicted by a capital letter and a small letter for, example B for a dominant allele and b for a recessive allele of a gene. The combination of both the genes after recombination defines the phenotype or the external expression of the characters of a particular person. The dominant allele of a gene expresses to form a protein, whereas the recessive allele does not express and is not involved in the phenotypic expression of the characters of a person. The recessive allele is expressed only in the homozygous recessive state, when the genes for the dominant phenotype are not present.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 9, Problem 4SQ

Summary Introduction

Introduction: The genes present on the chromosomes have alleles. They define the phenotypic and genotypic traits of the person. The types of alleles include dominant and recessive condition, which are depicted by a capital letter and a small letter for, example B for a dominant allele and b for a recessive allele of a gene. The combination of both the genes after recombination defines the phenotype or the external expression of the characters of a particular person. The dominant allele of a gene expresses to form a protein, whereas the recessive allele does not express and is not involved in the phenotypic expression of the characters of a person. The recessive allele is expressed only in the homozygous recessive state, when the genes for the dominant phenotype are not present.

Answer 6

Chapter 9, Problem 4SQ

Summary Introduction

Introduction: The genes present on the chromosomes have alleles. They define the phenotypic and genotypic traits of the person. The types of alleles include dominant and recessive condition, which are depicted by a capital letter and a small letter for, example B for a dominant allele and b for a recessive allele of a gene. The combination of both the genes after recombination defines the phenotype or the external expression of the characters of a particular person. The dominant allele of a gene expresses to form a protein, whereas the recessive allele does not express and is not involved in the phenotypic expression of the characters of a person. The recessive allele is expressed only in the homozygous recessive state, when the genes for the dominant phenotype are not present.

Answer 7

Chapter 9, Problem 4SQ

Summary Introduction

Introduction: The genes present on the chromosomes have alleles. They define the phenotypic and genotypic traits of the person. The types of alleles include dominant and recessive condition, which are depicted by a capital letter and a small letter for, example B for a dominant allele and b for a recessive allele of a gene. The combination of both the genes after recombination defines the phenotype or the external expression of the characters of a particular person. The dominant allele of a gene expresses to form a protein, whereas the recessive allele does not express and is not involved in the phenotypic expression of the characters of a person. The recessive allele is expressed only in the homozygous recessive state, when the genes for the dominant phenotype are not present.

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 9 - The genetic makeup of an organism is called its...Ch. 9 - Which of Mendels laws is represented by each...Ch. 9 - Prob. 3SQ Ch. 9 - Prob. 4SQ Ch. 9 - Prob. 5SQ Ch. 9 - Prob. 6SQ Ch. 9 - Prob. 7SQ Ch. 9 - Prob. 8SQ Ch. 9 - Prob. 9SQ Ch. 9 - Prob. 10SQ

Solution Summary: The author explains that the combination of the dominant and recessive alleles after recombination defines the phenotypic traits of a specific person.

Concept explainers

Videos

Want to see the full answer?

Chapter 9 Solutions