
Most nerve cells in the adult human central nervous system, as well as heart muscle cells, do not divide. In contrast, cells lining the inside of the small intestine divide frequently. Discuss this difference in terms of why damage to the nervous system and heart muscle cells (for example, that caused by a stroke or heart attack) is so dangerous. What do you think might happen to tissues such as the intestinal lining if a disorder blocked mitotic cell division in all cells of the body?

To discuss:
The reason why the damage to nervous system or heart muscle cells is so dangerous and things that will happen if the mitotic cell division of the cells lining the intestine is blocked.
Introduction:
The cell division involves a series of events which leads to the formation of daughter cells from the parent. There are two different types of the process through which the cell division can take place, namely- mitosis and meiosis.
Explanation of Solution
The nerve cells in the human adult central nervous system do not divide. The reason is unknown; however, it has been studied that molecular mechanisms might be involved that inhibit the outgrowth of axons. The local environment of the brain restricts the extensions of growth cones. Similarly, the heart cells do not divide. The myocytes or the heart cells actively perform functions and hence do not enter the cell cycle. Damage to nervous system cells and heart cells is dangerous because the damage cannot be repaired through the cell division of cells.
If somehow, the mitotic division of the cells of the intestine and the cells of the body is blocked, then the cells will not be replaced. Since, the cells lining the intestine divide frequently, the blocking of mitosis will have severe effects on the intestine. Cells lying inner to the intestinal layer would become exposed and they would also be damaged. The cells which divide frequently will be affected first.
Damage to nervous system and heart muscle cells would result in serious complications as the damage will not be repaired. If the mitosis of the intestinal lining cells will be blocked, the inner layer of cells will also get damaged as the intestinal layer divide frequently. The cells which divide more frequently will be affected first.
Want to see more full solutions like this?
Chapter 9 Solutions
Biology: Life on Earth with Physiology (11th Edition)
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning



