EBK CAMPBELL BIOLOGY
10th Edition
ISBN: 9780136539414
Author: Reece
Publisher: VST
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 8.5, Problem 2CC
Summary Introduction
To determine: Involvement of ATP in the feedback inhibition of a catabolic pathway.
Introduction: Feedback inhibition is a mechanism in multistep pathways that aids in ceasing the reaction when one of the substrates is over produced. The substrate that is being over produced bind to one of the enzymes of the reaction. This will in turn stop the whole cycle of reactions because each step is interdependent.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 8 Solutions
EBK CAMPBELL BIOLOGY
Ch. 8.1 - MAKE CONNECTIONS How does the second law of...Ch. 8.1 - Describe the forms of energy found in an apple as...Ch. 8.1 - WHAT IF? If you place a teaspoon of sugar in the...Ch. 8.2 - Cellular respiration uses glucose and oxygen,...Ch. 8.2 - VISUAL SKILLS How would the processes of...Ch. 8.2 - WHAT IF? Some nighttime partygoers wear glow-in-...Ch. 8.3 - How does ATP typically transfer energy from an...Ch. 8.3 - Prob. 2CCCh. 8.3 - MAKE CONNECTIONS Does Figure 8.11a show passive...Ch. 8.4 - Many spontaneous reactions occur very slowly. Why...
Ch. 8.4 - Prob. 2CCCh. 8.4 - WHAT IF? Malonate is an inhibitor of the enzyme...Ch. 8.4 - Prob. 4CCCh. 8.5 - How do an activator and an inhibitor have...Ch. 8.5 - Prob. 2CCCh. 8 - Explain how the highly ordered structure of a cell...Ch. 8 - Explain the meaning of each component in the...Ch. 8 - Describe the ATP cycle: How is ATP used and...Ch. 8 - How do both activation energy barriers and enzymes...Ch. 8 - Prob. 8.5CRCh. 8 - Choose the pair of terms that correctly completes...Ch. 8 - Prob. 2TYUCh. 8 - Which of the following metabolic processes can...Ch. 8 - Prob. 4TYUCh. 8 - Some bacteria art metabolically active in hot...Ch. 8 - If an enzyme is added to a solution where its...Ch. 8 - Prob. 7TYUCh. 8 - EVOLUTION CONNECTION Some people argue that...Ch. 8 - Prob. 9TYUCh. 8 - WRITE ABOUT A THEME: ENERGY AND MATTER Life...Ch. 8 - Prob. 11TYU
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anaerobic Respiration; Author: Bozeman Science;https://www.youtube.com/watch?v=cDC29iBxb3w;License: Standard YouTube License, CC-BY