Concept explainers
The following diagram describes the mRNA sequence of part of the A gene and the beginning of the B gene of phage ϕX174. In this phage, there are some genes that are read in overlapping reading frames. For example, the code for the A gene is used for part of the B gene, but the reading frame is displaced by one base. Shown here is the single mRNA with the codons for proteins A and B indicated.
aa# 5 6 7 8 9 10 11 12 13 14 15 16
A AlaLysGluTrpAsnAsnSerLeuLysThrLysLeu
mRNA GCUAAAGAAUGGAACAACUCACUAAAAACCAAGCUG
B MetGluGlnLeuThrLysAsnGlnAla
aa# 1 2 3 4 5 6 7 8 9
Given the following amino acid (aa) changes, indicate the base change that occurred in the mRNA and the consequences for the other protein sequence.
a. | Asn at position 10 in protein A is changed to Tyr. |
b. | Leu at position 12 in protein A is changed to Pro. |
c. | Gln at position 8 in protein B is changed to Leu. |
d. | The occurrence of overlapping reading frames is very rare in nature. When it does occur, the extent of the overlap is not very long. Why do you think this is the case? |
Want to see the full answer?
Check out a sample textbook solutionChapter 8 Solutions
Genetics: From Genes to Genomes, 5th edition
- How is a protein destined for the Endoplasmic Reticulum (ER), imported into the ER? Be concise.arrow_forwardFind out about the organisations and the movements aimed at the conservation of our natural resources. Eg Chipko movement and Greenpeace. Make a project report on such an organisation.arrow_forwardWhat are biofertilizers and mention the significancearrow_forward
- PCBs and River Otters: Otters in Washington State’s Green-Duwamish River have high levels of polychlorinated biphenyls (PCBs) in their livers. PCBs can bind to the estrogen receptors in animals and disrupt the endocrine system of these otters. The PCBs seem to increase the estrogen to androgen ratio, skewing the ratio toward too much estrogen. How would increased estrogen affect the river otter population? Based on your reading of the materials in this unit, what factors can affect fertility in humans? Explain how each of the factors affecting human fertility that you described can disrupt the human endocrine system to affect reproduction.arrow_forwardOther than oil and alcohol, are there other liquids you could compare to water (that are liquid at room temperature)? How is water unique compared to these other liquids? What follow-up experiment would you like to do, and how would you relate it to your life?arrow_forwardSelection of Traits What adaptations do scavengers have for locating and feeding on prey? What adaptations do predators have for capturing and consuming prey?arrow_forward
- Competition Between Species What natural processes limit populations from growing too large? What are some resources organisms can compete over in their natural habitat?arrow_forwardSpecies Interactions Explain how predators, prey and scavengers interact. Explain whether predators and scavengers are necessary or beneficial for an ecosystem.arrow_forwardmagine that you are conducting research on fruit type and seed dispersal. You submitted a paper to a peer-reviewed journal that addresses the factors that impact fruit type and seed dispersal mechanisms in plants of Central America. The editor of the journal communicates that your paper may be published if you make ‘minor revisions’ to the document. Describe two characteristics that you would expect in seeds that are dispersed by the wind. Contrast this with what you would expect for seeds that are gathered, buried or eaten by animals, and explain why they are different. (Editor’s note: Providing this information in your discussion will help readers to consider the significance of the research).arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax