Chapter 8, Problem 7P

The following diagram describes the mRNA sequence of part of the A gene and the beginning of the B gene of phage ϕX174. In this phage, there are some genes that are read in overlapping reading frames. For example, the code for the A gene is used for part of the B gene, but the reading frame is displaced by one base. Shown here is the single mRNA with the codons for proteins A and B indicated.

aa# 5 6 7 8 9 10 11 12 13 14 15 16

A AlaLysGluTrpAsnAsnSerLeuLysThrLysLeu

mRNA GCUAAAGAAUGGAACAACUCACUAAAAACCAAGCUG

B MetGluGlnLeuThrLysAsnGlnAla

aa# 1 2 3 4 5 6 7 8 9

Given the following amino acid (aa) changes, indicate the base change that occurred in the mRNA and the consequences for the other protein sequence.

a.	Asn at position 10 in protein A is changed to Tyr.
b.	Leu at position 12 in protein A is changed to Pro.
c.	Gln at position 8 in protein B is changed to Leu.
d.	The occurrence of overlapping reading frames is very rare in nature. When it does occur, the extent of the overlap is not very long. Why do you think this is the case?