Genetics: From Genes to Genomes, 5th edition
5th Edition
ISBN: 9780073525310
Author: Leland H. Hartwell, Michael L. Goldberg, Janice A. Fischer, Leroy Hood, Charles F. Aquadro
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 8, Problem 29P
The yeast gene encoding a protein found in the mitotic spindle was cloned by a laboratory studying mitosis. The gene encodes a protein of 477 amino acids.
| a. | What is the minimum length in |
| b. | A partial sequence of one DNA strand in an exon containing the middle of the coding region of the yeast gene is given here. What is the sequence of nucleotides of the mRNA in this region of the gene? Show the 5′and 3′ directionality of your strand. 5′ GTAAGTTAACTTTCGACTAGTCCAGGGT 3′ |
| c. | What is the sequence of amino acids in this part of the yeast mitotic spindle protein? |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Which of the following is the process that is "capable of destroying all forms of microbial life"?
Question 37 options:
Surgical scrub
Sterilization
Chemical removal
Mechanical removal
After you feel comfortable with your counting method and identifying cells in the various stages of mitosis, use the four images below of whitefish blastula to count the cells in each stage until you reach 100 total cells, recording your data below in Data Table 1. (You may not need to use all four images. Stop counting when you reach 100 total cells.)
After totaling the cells in each stage, calculate the percent of cells in each stage. (Divide total of stage by overall total of 100 and then multiply by 100 to obtain percentage.)
Data Table 1Stage Totals PercentInterphase Mitosis: Prophase Metaphase Anaphase Telophase Cytokinesis Totals 100 100%
To find the length of time whitefish blastula cells spend in each stage, multiply the percent (recorded as a decimal, in other words take the percent number and divide by 100) by 24 hours. (Example: If percent is 20%, then Time in Hours = .2 * 24 = 4.8) Record your data in Data…
What are Clathrin coated vesicles and what is their function?
Chapter 8 Solutions
Genetics: From Genes to Genomes, 5th edition
Ch. 8 - For each of the terms in the left column, choose...Ch. 8 - Match the hypothesis from the left column to the...Ch. 8 - How would the artificial mRNA 5GUGUGUGU . . . 3 be...Ch. 8 - An example of a portion of the T4 rIIB gene in...Ch. 8 - Consider Crick and Brenners experiments in Fig....Ch. 8 - The HbSsickle-cell allele of the human -globin...Ch. 8 - The following diagram describes the mRNA sequence...Ch. 8 - The amino acid sequence of part of a protein has...Ch. 8 - The results shown in Fig. 8.5 on p. 260 may have...Ch. 8 - Identify all the amino acid-specifying codons in...
Ch. 8 - Before the technology existed to synthesize RNA...Ch. 8 - A particular protein has the amino acid sequence...Ch. 8 - Prob. 13PCh. 8 - How many possible open reading frames frames...Ch. 8 - a. In Fig. 8.3 on p. 257, the physical map the...Ch. 8 - Charles Yanofsky isolated many different trpA-...Ch. 8 - Remembering that the wobble base of the tRNA is...Ch. 8 - The sequence of a segment of mRNA, beginning with...Ch. 8 - You identify a proflavin-generated allele of a...Ch. 8 - In certain bacterial species, pyrrolysine Pyl,...Ch. 8 - Describe the steps in transcription that require...Ch. 8 - Chapters 6 and 7 explained that mistakes made by...Ch. 8 - The coding sequence for gene F is read from left...Ch. 8 - If you mixed the mRNA of a human gene with the...Ch. 8 - Describe the steps in translation that require...Ch. 8 - Locate as accurately as possible the listed items...Ch. 8 - Concerning the figure for Problem 26: a. Which...Ch. 8 - In prokaryotes, a search for genes in a DNA...Ch. 8 - The yeast gene encoding a protein found in the...Ch. 8 - The sequence of a complete eukaryotic gene...Ch. 8 - Using recombinant DNA techniques which will be...Ch. 8 - a. The genetic code table shown in Fig. 8.2 on p....Ch. 8 - Arrange the following list of eukaryotic gene...Ch. 8 - Concerning the list of eukaryotic gene elements in...Ch. 8 - The human gene for 2 lens crystallin has the...Ch. 8 - Do you think each of the following types of...Ch. 8 - Null mutations are valuable genetic resources...Ch. 8 - The following is a list of mutations that have...Ch. 8 - Considering further the mutations described in...Ch. 8 - When 1 million cells of a culture of haploid yeast...Ch. 8 - Why is a nonsense suppressor tRNATyr, even though...Ch. 8 - Prob. 42PCh. 8 - You are studying mutations in a bacterial gene...Ch. 8 - Another class of suppressor mutations, not...Ch. 8 - Yet another class of suppressor mutations not...Ch. 8 - There is at least one nonsense suppressing tRNA is...Ch. 8 - Prob. 47PCh. 8 - Brenners m mutant phages m1 m6 described in Fig....
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- How is a protein destined for the Endoplasmic Reticulum (ER), imported into the ER? Be concise.arrow_forwardFind out about the organisations and the movements aimed at the conservation of our natural resources. Eg Chipko movement and Greenpeace. Make a project report on such an organisation.arrow_forwardWhat are biofertilizers and mention the significancearrow_forward
- PCBs and River Otters: Otters in Washington State’s Green-Duwamish River have high levels of polychlorinated biphenyls (PCBs) in their livers. PCBs can bind to the estrogen receptors in animals and disrupt the endocrine system of these otters. The PCBs seem to increase the estrogen to androgen ratio, skewing the ratio toward too much estrogen. How would increased estrogen affect the river otter population? Based on your reading of the materials in this unit, what factors can affect fertility in humans? Explain how each of the factors affecting human fertility that you described can disrupt the human endocrine system to affect reproduction.arrow_forwardOther than oil and alcohol, are there other liquids you could compare to water (that are liquid at room temperature)? How is water unique compared to these other liquids? What follow-up experiment would you like to do, and how would you relate it to your life?arrow_forwardSelection of Traits What adaptations do scavengers have for locating and feeding on prey? What adaptations do predators have for capturing and consuming prey?arrow_forward
- Competition Between Species What natural processes limit populations from growing too large? What are some resources organisms can compete over in their natural habitat?arrow_forwardSpecies Interactions Explain how predators, prey and scavengers interact. Explain whether predators and scavengers are necessary or beneficial for an ecosystem.arrow_forwardmagine that you are conducting research on fruit type and seed dispersal. You submitted a paper to a peer-reviewed journal that addresses the factors that impact fruit type and seed dispersal mechanisms in plants of Central America. The editor of the journal communicates that your paper may be published if you make ‘minor revisions’ to the document. Describe two characteristics that you would expect in seeds that are dispersed by the wind. Contrast this with what you would expect for seeds that are gathered, buried or eaten by animals, and explain why they are different. (Editor’s note: Providing this information in your discussion will help readers to consider the significance of the research).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Case Studies In Health Information ManagementBiologyISBN:9781337676908Author:SCHNERINGPublisher:Cengage
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Case Studies In Health Information Management
Biology
ISBN:9781337676908
Author:SCHNERING
Publisher:Cengage
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY