Chapter 8, Problem 30P

The sequence of a complete eukaryotic gene encoding the small protein Met Tyr Arg Gly Ala is shown here. All of the written sequences on the template strand are transcribed into RNA.

5′ CCCCTATGCCCCCCTGGGGGAGGATCAAAACACTTACCTGTACATGGC 3′

3′ GGGGATACGGGGGGACCCCCTCCTAGTTTTGTGAATGGACATGTACCG 5′

a.	Which strand is the template strand? In which direction (right to left or left to right) does RNA polymerase move along the template as it transcribes this gene?
b.	What is the sequence of the nucleotides in the processed mRNA molecule for this gene? Indicate the 5′ and 3′ polarity of this mRNA.
c.	A single base mutation in the gene results in synthesis of the peptide Met Tyr Thr. What is the sequence of nucleotides making up the mRNA produced by this mutant gene?