
Concept explainers
A human female with Turner syndrome (47, X) also expresses the X-linked trait hemophilia, as did her father. Which of her parents underwent nondisjunction during meiosis, giving rise to the gamete responsible for the syndrome?

To determine: The parent whose genome has undergone nondisjunction during meiosis that resulted in a human female with Turner syndrome (47, X) along with X-linked trait hemophilia.
Introduction: Turner syndrome is a condition in which female which is born have only 45 chromosomes and the missing chromosome is an X-chromosome. Since the X chromosome is missing the various proteins which are coded by the X-chromosome are affected. Thy symptoms of turner syndrome include short stature, reproductive sterility, visual impairments, nonverbal learning disability and various other conditions.
Explanation of Solution
Aneuploidy is a condition in which a person loses only one chromosome but the other complementary chromosome is present. In non-disjunction the chromosomes are unable to separate the linked homologs or chromatids during mitosis or meiosis.
Hemophilia is an X-linked trait and since the father and daughter both are suffering from this condition, this implies that the X chromosome from the father was inherited to the girl. So, it can be concluded that the Turner’s syndrome arises due to non-disjunction observed in the mother, which prevents the entry of X-chromosome from the mother resulting in only a single X-chromosome that has been inherited from the father.
The Turner syndrome is a result of nondisjunction of the chromosomes during the formation of gamete in mother.
Want to see more full solutions like this?
Chapter 8 Solutions
Concepts of Genetics (11th Edition)
Additional Science Textbook Solutions
Microbiology: An Introduction
Microbiology with Diseases by Body System (5th Edition)
Genetic Analysis: An Integrated Approach (3rd Edition)
Laboratory Experiments in Microbiology (12th Edition) (What's New in Microbiology)
Chemistry: An Introduction to General, Organic, and Biological Chemistry (13th Edition)
Organic Chemistry (8th Edition)
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning




