Microbiology: Principles and Explorations
9th Edition
ISBN: 9781118743164
Author: Jacquelyn G. Black, Laura J. Black
Publisher: WILEY
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 7, Problem 5SQ
From the DNA template sequence 3′-ATGCAGTAG-5′, what are the complementary messenger RNA sequence, transfer RNA anticodon sequences, and corresponding amino acids? Is there a terminator (nonsense) codon in the sequence? If so, what is it?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Using the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.
Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’.
2a). Following transcription, what is the total number of codons in the mRNA transcript?
2 b). Where is the start codon located in this mRNA transcript?
2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code table
For the anticodon sequences 5' IAA and 5' xm^3s^2UAA, considering the DNA sequences of the genes encoding the tRNAs(assuming both tRNAs exist even if that is not true), What is the sequence of the RNA-like strand of each tRNA gene that corresponds to the tRNA's anticodon? be sure to indicate polarities.
Chapter 7 Solutions
Microbiology: Principles and Explorations
Ch. 7 - Compare and contrast chromosomes in prokaryotes...Ch. 7 - DNA is not always the gemetic material. What are...Ch. 7 - How could mutations give rise to new alleles of a...Ch. 7 - How does trandlation differ from transcription?Ch. 7 - Distinguish between leading and lagging strands.Ch. 7 - What do 5 and 3 refer to? How do they determine...Ch. 7 - Contrast the three kinds of RNA. Does DNA make all...Ch. 7 - What feeds back in feedback inhibition? What does...Ch. 7 - What is the inducer for the lac operon?Ch. 7 - Compare enzyme induction and enzyme repression.
Ch. 7 - If you had be exposed to a mutagen,would you...Ch. 7 - How can a change in geneotype fail to produce a...Ch. 7 - Why are nitrates and nitrites, which have been...Ch. 7 - Cathy develops a painful cluster of blister-like...Ch. 7 - Prokaryotes usually have just one chromosome and...Ch. 7 - During the early stages of development of the...Ch. 7 - Suppose you are a medical technician working in a...Ch. 7 - Match the following terms with their descriptions:Ch. 7 - Prob. 2SQCh. 7 - Prob. 3SQCh. 7 - Match the following terms with their respective...Ch. 7 - From the DNA template sequence 3-ATGCAGTAG-5, what...Ch. 7 - What type of RNA carries and transfers amino acids...Ch. 7 - What type of RNA carries the genetic information...Ch. 7 - Which of the following statements does not...Ch. 7 - Prob. 9SQCh. 7 - For the lac operon, match the following:Ch. 7 - Prob. 11SQCh. 7 - A frameshift mutation occurs following the: (a)...Ch. 7 - Prob. 13SQCh. 7 - Which of the following schemes for molecular...Ch. 7 - Suppose a point mutation occurred in the third...Ch. 7 - Prob. 16SQCh. 7 - (a) Why are bacteria useful in the study of...Ch. 7 - DNA damage in the form of dimers induced by UV...Ch. 7 - Prob. 19SQCh. 7 - Name and describe the effects of the following...
Additional Science Textbook Solutions
Find more solutions based on key concepts
5. Distinguish between the anatomical neck and the surgical neck of the humerus. Name the proximal and distal p...
Principles of Anatomy and Physiology
Modified True/False 3. __________ Aquatic microorganisms are more prevalent near the surface than at the bottom...
Microbiology with Diseases by Body System (4th Edition)
Identify each of the following reproductive barriers as prezygotic or postzygotic a. One lilac species lives on...
Campbell Essential Biology (6th Edition) - standalone book
A pure-breeding tall plant producing oval fruit as described in Problem 2 is crossed to a pure-breeding short p...
Genetic Analysis: An Integrated Approach (3rd Edition)
2. The structural and function unit of life is (a) a cell, (b) an organ, (c) the organism, (d) a molecule.
Human Anatomy & Physiology (Marieb, Human Anatomy & Physiology) Standalone Book
WHAT IF? Is allopatric speciation more likely to occur on an island close to a mainland or on a more isolated i...
Campbell Biology in Focus (2nd Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What is an Okazaki fragment, and how are they later “glued” together? What are the types and major functions for each type of RNA? Define transcription and translation. Which process occurs first to make protein from DNA? In what direction does a polymerase move when synthesizing a strand of mRNA? What mRNA sequence is synthesized from a section of DNA that is 3’-TTGACCT-5’?arrow_forwardin the human gene for the beta chain of hemoglobin, the first 30 nucleotides in the amino acid coding region is represented by the sequence 3'TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? If the DNA duplex for the beta chain of hemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.arrow_forwardThere are four codons that encode threonine. Consider the leader sequence in Figure 31.22A. What codons are used and with what frequency?arrow_forward
- By base-pair substitution, what are all the synonymouschanges that can be made starting with the codon CGG?arrow_forward5'......TACTGCCCATGCCCAGAGAGAAAGCGCAGACGCGTCTAAactgt... 3' a). (10 points). In the above sequences, the open reading frame is indicated by alternating non-underlined and underlined triplets. Please use the codon table to deduce the amino acid sequence for the region shown in the wildtype protein. Wildtype AA sequence for the region around mutation #1: Wildtype AA sequence for the region around mutation #2: b). (10 points). Please make predictions what molecular change mutation #1 and mutation #2 cause. c). (5 points). Which mutation is more likely to abrogate the protein function? Why?arrow_forwardConsider the tryptophan codon 5′ - UGG - 3′ in the standard genetic code . Can a single base change in this codon create a synonymous mutation? Can a single base change in this codon create a nonsense codon?arrow_forward
- Three E. coli tRNA molecules with the anticodon sequences CGG, OGG , and UGG are charged with the same amino acid. What is the amino acid ?arrow_forwardA double-stranded fragment of viral DNA, one of whose strands is shown below, encodes two peptides, called vir-1 and vir-2. Adding this double-stranded DNA fragment to an in vitro transcription and translation system yields peptides of 10 residues (vir-1) and 5 residues (vir-2). Solve, (b) Determine the amino acid sequence of each peptide.arrow_forwardCodons in the set CUU, CUC, CUA, and CUG all code for the amino acid leucine. In this set, the first and second bases are identical; the identity of the third base is irrelevant. For what other sets of codons is the third base also irrelevant? For what amino acid(s) does each set code?arrow_forward
- The following represent deoxyribonucleotide sequences in the template strand of DNA: Sequence 1: 5′-CTTTTTTGCCAT-3′ Sequence 2: 5′-ACATCAATAACT-3′ Sequence 3: 5′-TACAAGGGTTCT-3′ (a) For each strand, determine the mRNA sequence that would be derived from transcription. (b) Using Figure 12–7, determine the amino acid sequence that is encoded by these mRNAs. (c) For Sequence 1, what is the sequence of the partner DNA strand?arrow_forwardAccording to wobble rules, what codons should be recognized by the follow- ing anticodons? What amino acid residues do these correspond to? (а) 5' —1CC—3' (b) 5'-GCU-3'arrow_forward5'....TACTGCCCATGCCCAGAGAGAAAGCGCAGACGCGTCTAA actgt... 3' a). (10 points). In the above sequences, the open reading frame is indicated by alternating non-underlined and underlined triplets. Please use the codon table to deduce the amino acid sequence for the region shown in the wildtype protein. Wildtype AA sequence for the region around mutation #1: Wildtype AA sequence for the region around mutation #2: b). (10 points). Please make predictions what molecular change mutation #1 and mutation #2 cause. c). (5 points). Which mutation is more likely to abrogate the protein function? Why?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY