Microbiology: Principles and Explorations
9th Edition
ISBN: 9781118743164
Author: Jacquelyn G. Black, Laura J. Black
Publisher: WILEY
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 7, Problem 15SQ
Suppose a point mutation occurred in the third position of a codon in a DNA template Coding for a protein, changing it from TTT to TTC. What would be the consequences of this mutation?
- (a) It would cause a frameshift mutation downstream of the point mutation, resulting in a different protein.
- (b) It would cause a different amino acid to be placed at this position in the polypeptide, making it a mutant protein.
- (c) There would be no change in the amino acid at this position because, of the redundancy of the genetic code. Such point mutations are known as “silent mutations” because, although the genotype is different, the
phenotype remains the same. - (d) All of the above.
- (e) None of the above.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Suppose that a gene underwent a mutation that changed a GAA codon to UAA. (a) Name the amino acid encoded by the original triplet. (b) Identify a tRNA anticodon that could translate the nonsense UAA triplet. (c) What other amino acid could be encoded by the mutant tRNA?
The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution mutations (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons.(a) How many total mutations are possible?(b) How many of these mutations are “silent,” in the sense that the mutantcodon is changed to another Arg codon?(c) How many of these mutations are conservative, in the sense that an Argcodon is changed to a functionally similar Lys codon?
Sickle cell anemia is a widespread disease in many African countries and can be caused by a
change in the amino acid sequence from glutamic acid to valine. A patient is diagnosed with
the disease and a genetic fingerprint reveals the following DNA sequence for the gene:
(a)
(b)
(c)
(d)
(e)
Write down the mRNA sequence for the given DNA sense strand indicating the
polarity.
Derive the polypeptide from the mRNA molecule using the table of the genetic code
(Table Q1 below) again indicating the polarity of the peptide chain.
Indicate the position in the DNA molecule that could have caused the disease and write
down all possible point mutations in the DNA sequence that could have caused it. [
The polypeptide chain is polymerized at the ribosomes using t-RNA molecules. Write
down all possible t-RNA molecules with their anti-codons that are used to polymerize
the amino acid VAL. Indicate the polarity.
3'-TAC TGA GCA AGA TTA CAT ACT-5'
Explain what is meant by redundancy of the genetic code.…
Chapter 7 Solutions
Microbiology: Principles and Explorations
Ch. 7 - Compare and contrast chromosomes in prokaryotes...Ch. 7 - DNA is not always the gemetic material. What are...Ch. 7 - How could mutations give rise to new alleles of a...Ch. 7 - How does trandlation differ from transcription?Ch. 7 - Distinguish between leading and lagging strands.Ch. 7 - What do 5 and 3 refer to? How do they determine...Ch. 7 - Contrast the three kinds of RNA. Does DNA make all...Ch. 7 - What feeds back in feedback inhibition? What does...Ch. 7 - What is the inducer for the lac operon?Ch. 7 - Compare enzyme induction and enzyme repression.
Ch. 7 - If you had be exposed to a mutagen,would you...Ch. 7 - How can a change in geneotype fail to produce a...Ch. 7 - Why are nitrates and nitrites, which have been...Ch. 7 - Cathy develops a painful cluster of blister-like...Ch. 7 - Prokaryotes usually have just one chromosome and...Ch. 7 - During the early stages of development of the...Ch. 7 - Suppose you are a medical technician working in a...Ch. 7 - Match the following terms with their descriptions:Ch. 7 - Prob. 2SQCh. 7 - Prob. 3SQCh. 7 - Match the following terms with their respective...Ch. 7 - From the DNA template sequence 3-ATGCAGTAG-5, what...Ch. 7 - What type of RNA carries and transfers amino acids...Ch. 7 - What type of RNA carries the genetic information...Ch. 7 - Which of the following statements does not...Ch. 7 - Prob. 9SQCh. 7 - For the lac operon, match the following:Ch. 7 - Prob. 11SQCh. 7 - A frameshift mutation occurs following the: (a)...Ch. 7 - Prob. 13SQCh. 7 - Which of the following schemes for molecular...Ch. 7 - Suppose a point mutation occurred in the third...Ch. 7 - Prob. 16SQCh. 7 - (a) Why are bacteria useful in the study of...Ch. 7 - DNA damage in the form of dimers induced by UV...Ch. 7 - Prob. 19SQCh. 7 - Name and describe the effects of the following...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Explain how biosensors might be used for water quality testing. Would biosensors give more accurate identificat...
Microbiology with Diseases by Taxonomy (5th Edition)
WHAT IF? Suppose a new fishery is discovered, and you are put in charge of developing it sustainably. What eco...
Campbell Biology (11th Edition)
1. The correct sequence of levels forming the structural hierarchy is
A. (a) organ, organ system, cellular, che...
Human Anatomy & Physiology (11th Edition)
Identify each of the following reproductive barriers as prezygotic or postzygotic. a. One lilac species lives o...
Campbell Essential Biology with Physiology (5th Edition)
Identify each of the following reproductive barriers as prezygotic or postzygotic. a. One lilac species lives o...
Campbell Essential Biology with Physiology (6th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A segment of DNA has the followimg sequence of bases.. 5'-ATGCAATGATATTGAAGCTTA-3' a) What sequence of bases would appear in mRNA transcribed from this segment? b) Assume the first base in this mRNA is the beginning of a codon. What order of amino acid would be translated into a polypeptide synthesized along this segment? c) Give anticodons for each tRNA associated with the translation in part (b)arrow_forwardHow does the cell ensure that a specific amino acid (say, valine) attaches itself only to the one tRNA molecule that is specific for valine? (A) Proteins called aminoacyl DNA synthetases are responsible for bringing together the proper pair. The enzymes match the amino acid and one of the correct DNA molecules carrying the right anticodon. (B) Lipids called aminoacyl tRNA synthetases are responsible for bringing together the proper pair. The lipid binds the amino acid and one of the correct tRNA molecules carrying the right codon. (C) Enzymes called aminoacyl tRNA synthetases are responsible for bringing together the proper pair. The enzymes match the amino acid and one of the correct tRNA molecules carrying the right anticodon. (D) Enzymes called peptidyl mRNA synthetases are responsible for bringing together the proper pair. The enzymes match the amino acid and one of the correct mRNA molecules carrying the right anticodon.arrow_forwardA tRNA is charged with the amino acid methionine.(i) Give the anti-codon of this tRNA.(ii) Write the Codon for methionine.(iii) Name the enzyme responsible for binding of amino acid to tRNAarrow_forward
- In your own wordsarrow_forwardA segment of template DNA is known to contain the following base sequence: 3' GATACCTTTGTGTAGTCATCTT 5' a) Write the mRNA that would be transcribed from this DNA fragment. b) Highlight the starter and the stopper in your mRNA sequence. Write the sequence of amino acids which would be encoded in translation. asap pleasearrow_forwardConsider a stretch of DNA (a hypothetical gene) that has the sequence 5’ ATG-CTA-TCA-TGG-TTC-TAA 3’ A) Transcribe and translate this gene using the genetic code table. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. B) Now, our hypothetical gene has undergone a mutation. The mutant sequence is....3’ TAC-GAT-AGT-ACC-AAT-ATT 5’5’ ATG-CTA-TCA-TGG-TTA-TAA 3’ Transcribe and translate the mutant sequence. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. C) Indicate the type of mutation (nonsense, missense, silent, or frame shift) present. D) How severe of a consequence will this mutation likely be in terms of protein function (none, mild, moderate or severe)? Why?arrow_forward
- The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1) Find the sequence of the MRNA that would be made from this gene. 2) Find the amino acid protein sequence that would be made from this gene 3) A mutation occurs at position 17 of the coding DNA strand, where the Tis substituted with A (count from 5' end of coding strand). Write the resulting mRNA and protein sequences. Show all your work!arrow_forwardThe coding DNA strand of a gene has the following DNA sequence: 5’ ATGGCGACGATAATGTTGTGTGAGTGA 3’ 1) Find the sequence of the mRNA that would be made from this gene. 2) Find the amino acid protein sequence that would be made from this gene 3) A mutation occurs at position 17 of the coding DNA strand, where the T is substituted with A (count from 5’ end of coding strand). Write the resulting mRNA and protein sequences. Show all your work!arrow_forwarda) Examine the nucleotide sequence below, and determine the amino acid sequence encoded by this mRNA. (2) 5' CCUCCGGACCGGAUGCCCGCGGCAGCUGCUGAACCAUGGCCCGCGGGUGAGCCAAGGAGGAGGGC 3' b) What would be the consequence of a mutation that resulted in changing the underlined nucleotide to a G? (2) Second base U G. Consensus sequences functioning in transcription or translation (5-3): UGU UAU UCU Phe UCC Ser UCA Leu UCG UUU Tyr Cys TATA box (-25) TATAAA UUC UAC UGC UAA Stop UGA Stop A UAG Stop UGG Trp G UUA TFIIB recognition element /c/c/¢CGCC UUG TATAAT CGU CAU His CAC Pro CAA Gln CAG -10 (Pribnow) sequence CUU CCU CC Leu CCA CGC Arg CGA CUC TTGACA -35 sequence CỦA CUG CCG CGG Shine-Dalgarno sequence (Ribosome binding site) UAAGGAGGU YYANT/AYY AGU Asn AGC AUU ACU AAU Ser Initiator element AUC lle ACC Thr AAC AGA Lys AGG AUA ACA AAA lA AGLGU ^/G AGU Arg Intron 5' splice site AUG Met ACG AAG CAGIG GGU GAU Asp GAC Intron 3' splice site GCU GUU GCC Val GCA GGC Gly GGA GUC AAUAAA Ala Cleavage site…arrow_forward
- Given the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?arrow_forwardOrder+the+following+of+protein+sentesis+sequence+from+earliest: (a)tRNA molecule bring specific amino acids to he mRNA molecule. b)mRNA nucleotides join with exposed DNA bases and form a molecule of mRNA.(c)The two stands of a DNA molecule separate. (d)Peptide bonds form between the amino acids. (e)the mRNA molecule leave the nucleus. (f) a ribosome attached to the mRNA molecule.arrow_forwardUse this genetic code table for some of the questions ahead. You do not need to memorize the code, except for the start codon (AUG = Met) and the stop codons (UAA, UAG, UGA). Which of the following statements about the genetic code is correct? A) All codons specify more than one amino acid. B) The genetic code is redundant. C) All amino acids are specified by more than one codon. D) All codons specify an amino acid.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY