
Human Anatomy
9th Edition
ISBN: 9780135168059
Author: Marieb, Elaine Nicpon, Brady, Patricia, Mallatt, Jon
Publisher: Pearson Education, Inc.,
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 6, Problem 23CYU
Why is age-related bone loss greater in women than in men?
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
Chapter 6 Solutions
Human Anatomy
Ch. 6 - How does the matrix differ in each of the three...Ch. 6 - Which type of cartilage is most abundant? List...Ch. 6 - Where are the chondroblasts located that produce...Ch. 6 - Which component of bone tissue contributes to the...Ch. 6 - What minerals are stored. in bone, and which cells...Ch. 6 - What is the difference between an osteoblast and....Ch. 6 - What are the two osteogenic membranes found in a...Ch. 6 - Prob. 8CYUCh. 6 - What is the function of each of the following bone...Ch. 6 - Differentiate between a central canal, a...
Ch. 6 - How do the osteocytes in the outer lamella of an...Ch. 6 - What is a trabecula? How is it different from an...Ch. 6 - Which bones of the skeleton are membranous bones?Ch. 6 - Which portion of the long bones in a 6-month-old...Ch. 6 - As a bone grows in length during childhood, does...Ch. 6 - How does exercise affect bone? Why?Ch. 6 - How does bone remodeling help repair a bone after...Ch. 6 - Prob. 18CYUCh. 6 - Which diseases result from inadequate...Ch. 6 - Prob. 20CYUCh. 6 - At what age can you best prevent the development...Ch. 6 - At what age do bones begin to ossify? At what age...Ch. 6 - Why is age-related bone loss greater in women than...Ch. 6 - Which is a function of the skeletal system? (a)...Ch. 6 - Prob. 2RQCh. 6 - The perichondriurn of cartilage is similar to the ...Ch. 6 - Use the key to indicate the type of cartilage that...Ch. 6 - Indicate whether each of the following statements...Ch. 6 - A bone that has essentially the same width,...Ch. 6 - The shaft of a long bone is properly called the...Ch. 6 - Match the function of bone markings described in...Ch. 6 - Which listed feature is found in compact bone but...Ch. 6 - The flat bones of the skull develop from (a)...Ch. 6 - The following events apply to the endochondral...Ch. 6 - The remodeling of bone tissue is a function of...Ch. 6 - osteoprogenitor cells are located in (a) the...Ch. 6 - Prob. 14RQCh. 6 - The disorder in which bones are porous and thin...Ch. 6 - Where within an epiphyseal plate is the calcified...Ch. 6 - Prob. 17RQCh. 6 - Match the cells listed in column B with the...Ch. 6 - Explain (a) why cartilages are resilient and (b)...Ch. 6 - Some anatomy students are joking between classes,...Ch. 6 - When and why do the epiphyseal plates close?Ch. 6 - During what period of life does skeletal mass...Ch. 6 - In a piece of cartilage in the young skeleton,...Ch. 6 - Differentiate the following: osteoclast,...Ch. 6 - List three structural features of cartilage and...Ch. 6 - Explain why people con�ned to wheelchairs...Ch. 6 - While walking home from class, 52-year-old Ike...Ch. 6 - Carlos went to weight-lifting camp in the summer...Ch. 6 - Ming posed the following question: “If the...Ch. 6 - Old Norse stories tell of a famous Viking named...Ch. 6 - Prob. 6CRCAQCh. 6 - Why might repeated pregnancies cause a woman to...Ch. 6 - Traditional treatments for osteoporosis address...Ch. 6 - Using the word roots from this and previous...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningMedical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage LearningHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning


Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
TISSUE REPAIR Part 1: Repair - Regeneration; Author: ilovepathology;https://www.youtube.com/watch?v=t-5EjlS6qjk;License: Standard YouTube License, CC-BY