
Microbiology: A Systems Approach
4th Edition
ISBN: 9780073402437
Author: Marjorie Kelly Cowan Professor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 5.5, Problem 19AYP
Summary Introduction
To determine:
The three types of locomotion exhibited by protozoa.
Concept introduction:
Protozoans are unicellular eukaryotes that live or feed on organic material such as other microorganism or debris. They can either be a
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 5 Solutions
Microbiology: A Systems Approach
Ch. 5.1 - Relate bacterial, archaeal, and eukaryotic cells...Ch. 5.1 - List the types of eukaryotic microorganisms and...Ch. 5.2 - Differentiate between cilia and flagella in...Ch. 5.2 - Prob. 4AYPCh. 5.2 - Prob. 5AYPCh. 5.2 - Prob. 6AYPCh. 5.3 - Describe the main structural components of a...Ch. 5.3 - Diagram how the nucleus, endoplasmic reticulum,...Ch. 5.3 - Explain the function of the mitochondrion.Ch. 5.3 - Prob. 10AYP
Ch. 5.3 - Prob. 11AYPCh. 5.3 - Prob. 12AYPCh. 5.4 - Prob. 13AYPCh. 5.4 - Differentiate among the terms heterotroph,...Ch. 5.4 - Prob. 15AYPCh. 5.4 - Prob. 16AYPCh. 5.4 - Prob. 17AYPCh. 5.5 - Prob. 2CFCh. 5.5 - Prob. 18AYPCh. 5.5 - Prob. 19AYPCh. 5.5 - Prob. 20AYPCh. 5.5 - Prob. 21AYPCh. 5.6 - Prob. 22AYPCh. 5.6 - Summarize the stages of a typical helminth life...Ch. 5 - Prob. 1CFCh. 5 - Both flagella and cilia are found primarily in a....Ch. 5 - Features of the nuclear envelope include a....Ch. 5 - The cell wall is found in which eukaryotes? a....Ch. 5 - Prob. 4MCQCh. 5 - Algae generally contain some type of a. spore. b....Ch. 5 - Almost all protozoa have a a. locomotor organelle....Ch. 5 - All mature sporozoa are a. parasitic. b....Ch. 5 - Parasitic helminths reproduce with a. spores. b....Ch. 5 - Mitochondria likely originated from a. archaea. b....Ch. 5 - Most helminth infections a. are localized to one...Ch. 5 - Prob. 11TFCh. 5 - Prob. 12TFCh. 5 - Prob. 13TFCh. 5 - Prob. 14TFCh. 5 - Prob. 15TFCh. 5 - Summarize the endosymbiotic theory and explain how...Ch. 5 - Prob. 2CTQCh. 5 - Compare and contrast the structure and function of...Ch. 5 - Write a paragraph illustrating the life of a...Ch. 5 - Prob. 5CTQCh. 5 - Prob. 6CTQCh. 5 - Prob. 7CTQCh. 5 - Prob. 8CTQCh. 5 - Prob. 9CTQCh. 5 - Prob. 10CTQCh. 5 - Prob. 1CCCh. 5 - Prob. 2CCCh. 5 - Prob. 3CCCh. 5 - Prob. 1VCCh. 5 - Prob. 2VCCh. 5 - Using the words that follow, please create a...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning


Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning