
Pearson eText Human Anatomy -- Instant Access (Pearson+)
9th Edition
ISBN: 9780135273005
Author: Elaine Marieb, Patricia Wilhelm
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Question
Chapter 5, Problem 14CYU
Summary Introduction
To review:
The explanation for temporary loss of hair from chemotherapy while permanent loss from severe burn.
Introduction:
The skin has three layers namely- epidermis, dermis, and subcutaneous layer. The dermis contains hair follicles, glandular cells, blood vessels, and connective tissues. The dermis layer provides elasticity to the skin and the sense of touch and pain by the presence of sensory receptors. The hair follicles have three layers where the outer layer is the cuticle, the middle is the cortex, and the innermost layer is medulla which is also known as the central core of the hair follicle.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 5 Solutions
Pearson eText Human Anatomy -- Instant Access (Pearson+)
Ch. 5 - What is the meaning of the word roots epi-, sub:...Ch. 5 - Name the �ve major functions of skin.Ch. 5 - Which layers of the epidermis contain living...Ch. 5 - Which functions of skin are performed by cells...Ch. 5 - Prob. 5CYUCh. 5 - Prob. 6CYUCh. 5 - Prob. 7CYUCh. 5 - What types of cells are found in the dermis, and...Ch. 5 - Which pigment causes the large variation in human...Ch. 5 - Prob. 10CYU
Ch. 5 - Prob. 11CYUCh. 5 - Prob. 12CYUCh. 5 - Prob. 13CYUCh. 5 - Prob. 14CYUCh. 5 - Prob. 15CYUCh. 5 - Prob. 16CYUCh. 5 - Prob. 17CYUCh. 5 - Prob. 18CYUCh. 5 - What are the two life-threatening concerns...Ch. 5 - Prob. 20CYUCh. 5 - Prob. 21CYUCh. 5 - Prob. 22CYUCh. 5 - Prob. 1RQCh. 5 - Match each epidermal layer in column B to its...Ch. 5 - The ability of the epidermis to resist rubbing and...Ch. 5 - Skin color is determined by (a) melanin, (b)...Ch. 5 - Prob. 5RQCh. 5 - Prob. 6RQCh. 5 - Use logic to deduce the answer to this question....Ch. 5 - Prob. 8RQCh. 5 - Prob. 9RQCh. 5 - Prob. 10RQCh. 5 - Prob. 11RQCh. 5 - The reticular layer of the dermis (a) provides...Ch. 5 - Match the skin structures in column B with their...Ch. 5 - Thick skin differs from thin skin in (a) the...Ch. 5 - From the list of tissues in column B, identify the...Ch. 5 - Prob. 16RQCh. 5 - Explain why thin skin is also called hairy skin,...Ch. 5 - Prob. 18RQCh. 5 - Why does skin that is exposed to sunlight age so...Ch. 5 - Explain why no skin cancers originate from stratum...Ch. 5 - Explain each of these familiar phenomena in terms...Ch. 5 - Prob. 22RQCh. 5 - List �ve functions of the skin.Ch. 5 - Prob. 24RQCh. 5 - What type of tissue(s) form each of the following...Ch. 5 - Prob. 26RQCh. 5 - Prob. 1CRCAQCh. 5 - Dean, a 40-year-old beach boy, tells you that his...Ch. 5 - Long-term patients con�ned to hospital beds are...Ch. 5 - Carmen slipped on some ice and split her chin on...Ch. 5 - A man got his �nger caught in a machine at the...Ch. 5 - Prob. 6CRCAQCh. 5 - Why are melanomas the most common type of skin...Ch. 5 - What are the harmful effects of UV radiation, and...Ch. 5 - Prob. 9CRCAQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Essentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:Cengage
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College
Essentials of Pharmacology for Health Professions
Nursing
ISBN:9781305441620
Author:WOODROW
Publisher:Cengage

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
The Integumentary System, Part 1 - Skin Deep: Crash Course Anatomy & Physiology #6; Author: CrashCourse;https://www.youtube.com/watch?v=Orumw-PyNjw;License: Standard youtube license