Pearson eText Human Anatomy -- Instant Access (Pearson+)
9th Edition
ISBN: 9780135273005
Author: Elaine Marieb, Patricia Wilhelm
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Question
Chapter 5, Problem 10CYU
Summary Introduction
To review:
The concern of dark-skinned people living in the northern latitudes about the production of vitamin D.
Introduction:
Vitamins are organic compounds that are required by the body in small amounts. Various forms of vitamins are consumed from various food particles. Vitamin D can also be produced by the and is produced by the melanocyte cells. They regulate cells in the exposure of sun rays. Melanin pigment is present in the basal layer of the epidermis result in the absorption of ultraviolet rays and protects the body from damage.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 5 Solutions
Pearson eText Human Anatomy -- Instant Access (Pearson+)
Ch. 5 - What is the meaning of the word roots epi-, sub:...Ch. 5 - Name the �ve major functions of skin.Ch. 5 - Which layers of the epidermis contain living...Ch. 5 - Which functions of skin are performed by cells...Ch. 5 - Prob. 5CYUCh. 5 - Prob. 6CYUCh. 5 - Prob. 7CYUCh. 5 - What types of cells are found in the dermis, and...Ch. 5 - Which pigment causes the large variation in human...Ch. 5 - Prob. 10CYU
Ch. 5 - Prob. 11CYUCh. 5 - Prob. 12CYUCh. 5 - Prob. 13CYUCh. 5 - Prob. 14CYUCh. 5 - Prob. 15CYUCh. 5 - Prob. 16CYUCh. 5 - Prob. 17CYUCh. 5 - Prob. 18CYUCh. 5 - What are the two life-threatening concerns...Ch. 5 - Prob. 20CYUCh. 5 - Prob. 21CYUCh. 5 - Prob. 22CYUCh. 5 - Prob. 1RQCh. 5 - Match each epidermal layer in column B to its...Ch. 5 - The ability of the epidermis to resist rubbing and...Ch. 5 - Skin color is determined by (a) melanin, (b)...Ch. 5 - Prob. 5RQCh. 5 - Prob. 6RQCh. 5 - Use logic to deduce the answer to this question....Ch. 5 - Prob. 8RQCh. 5 - Prob. 9RQCh. 5 - Prob. 10RQCh. 5 - Prob. 11RQCh. 5 - The reticular layer of the dermis (a) provides...Ch. 5 - Match the skin structures in column B with their...Ch. 5 - Thick skin differs from thin skin in (a) the...Ch. 5 - From the list of tissues in column B, identify the...Ch. 5 - Prob. 16RQCh. 5 - Explain why thin skin is also called hairy skin,...Ch. 5 - Prob. 18RQCh. 5 - Why does skin that is exposed to sunlight age so...Ch. 5 - Explain why no skin cancers originate from stratum...Ch. 5 - Explain each of these familiar phenomena in terms...Ch. 5 - Prob. 22RQCh. 5 - List �ve functions of the skin.Ch. 5 - Prob. 24RQCh. 5 - What type of tissue(s) form each of the following...Ch. 5 - Prob. 26RQCh. 5 - Prob. 1CRCAQCh. 5 - Dean, a 40-year-old beach boy, tells you that his...Ch. 5 - Long-term patients con�ned to hospital beds are...Ch. 5 - Carmen slipped on some ice and split her chin on...Ch. 5 - A man got his �nger caught in a machine at the...Ch. 5 - Prob. 6CRCAQCh. 5 - Why are melanomas the most common type of skin...Ch. 5 - What are the harmful effects of UV radiation, and...Ch. 5 - Prob. 9CRCAQ
Knowledge Booster
Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Nutrition Through The Life CycleHealth & NutritionISBN:9781337919333Author:Brown, Judith E.Publisher:Cengage Learning,Health Safety And Nutrition F/Young ChildHealth & NutritionISBN:9781305144767Author:MAROTZPublisher:Cengage
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Nutrition Through The Life Cycle
Health & Nutrition
ISBN:9781337919333
Author:Brown, Judith E.
Publisher:Cengage Learning,
Health Safety And Nutrition F/Young Child
Health & Nutrition
ISBN:9781305144767
Author:MAROTZ
Publisher:Cengage