
Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 5, Problem 10EQ
Summary Introduction
To review:
Northern blotting method and mutation affecting the length of mRNA(messenger ribonucleic acid), that is transcribed from a gene.
Introduction:
Northern blotting is a method used in molecular biology research to study gene expression(the process by which the information from the gene is used in the synthesis of a functional gene product). Electrophoresis technique (separation ofcharged molecules like RNA(ribonucleic acid) and DNA(deoxyribonucleic acid) by size) is used in northern blotting technique for separating the RNA sample by size.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Chapter 5 Solutions
Genetics: Analysis and Principles
Ch. 5.1 - A female snail that coils to the left has...Ch. 5.1 - 2. What is the molecular explanation for maternal...Ch. 5.2 - 1. In fruit flies, dosage compensation is achieved...Ch. 5.2 - 2. According to the Lyon hypothesis,
a. one of...Ch. 5.2 - Prob. 3COMQCh. 5.3 - 1. In mice, the copy of the Igf2 gene that is...Ch. 5.3 - 2. A female mouse that is is crossed to a male...Ch. 5.3 - Prob. 3COMQCh. 5.3 - Prob. 4COMQCh. 5.4 - 1. Extranuclear inheritance occurs due to
a....
Ch. 5.4 - 2. A cross is made between a green four-o’clock...Ch. 5.4 - 3. Some human diseases are caused by mutations in...Ch. 5.4 - 4. Chloroplasts and mitochondria evolved from an...Ch. 5 - Define the term epigenetic inheritance, and...Ch. 5 - 2. Describe the inheritance pattern of maternal...Ch. 5 - A maternal effect gene exists in a dominant N...Ch. 5 - 4. A Drosophila embryo dies during early...Ch. 5 - 5. For Mendelian inheritance, the nuclear genotype...Ch. 5 - Suppose a maternal effect gene exists as a...Ch. 5 - Suppose that a gene affects the anterior...Ch. 5 - Explain why maternal effect genes exert their...Ch. 5 - As described in Chapter 22, researchers have been...Ch. 5 - 10. With regard to the numbers of sex chromosomes,...Ch. 5 - 11. What is a Barr body? How is its structure...Ch. 5 - Among different species, describe three distinct...Ch. 5 - 13. Describe when X-chromosome inactivation occurs...Ch. 5 - 14. Describe the molecular process of X-chromosome...Ch. 5 - Prob. 15CONQCh. 5 - 16. How many Barr bodies would you expect to find...Ch. 5 - 17. Certain forms of human color blindness are...Ch. 5 - A black female cat (XBXB) and an orange male cat...Ch. 5 - Prob. 19CONQCh. 5 - When does the erasure and reestablishment phase of...Ch. 5 - In what types of cells would you expect de novo...Ch. 5 - 22. On rare occasions, people are born with a...Ch. 5 - Genes that cause Prader-Willi syndrome and...Ch. 5 - Prob. 24CONQCh. 5 - What is extranuclear inheritance? Describe three...Ch. 5 - Prob. 26CONQCh. 5 - Among different species, does extranuclear...Ch. 5 - Extranuclear inheritance often correlates with...Ch. 5 - Prob. 29CONQCh. 5 - Prob. 30CONQCh. 5 - Which of the following traits or diseases is (are)...Ch. 5 - Prob. 32CONQCh. 5 - 33. Describe how a biparental pattern of...Ch. 5 - Figure 5.1 describes an example of a maternal...Ch. 5 - 2. Discuss the types of experimental observations...Ch. 5 - Prob. 3EQCh. 5 - As a hypothetical example, a trait in mice results...Ch. 5 - You have a female snail that coils to the right,...Ch. 5 - Prob. 6EQCh. 5 - 7. Figure 5.6 describes the results of...Ch. 5 - Prob. 8EQCh. 5 - In the experiment of Figure 5.6, why does a clone...Ch. 5 - Prob. 10EQCh. 5 - 11. A variegated trait in plants is analyzed using...Ch. 5 - 1. Recessive maternal effect genes are identified...Ch. 5 - Prob. 2QSDC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning


Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY