Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 5, Problem 1EQ
Figure 5.1 describes an example of a maternal effect gene. Explain how Sturtevant deduced a maternal effect gene based on the
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can you suggest how we could have determined whether Bill’s aunts were carriers of the mutant BTK gene? Give the name for the procedure and brief explanation of how it’s done and the anticipated results. What controls would be needed?
What is a molecular marker? Give two examples. Discuss why it isgenerally easier to locate and map molecular markers rather thanfunctional genes.
Alpha-1 antitrypsin has codominant inheritance. M genes express normal levels. S
and Z genes have low expression. Which of the following is most likely to develop
emphyema? A person with:
1) two M genes who does smoke
2) two S genes who does smoke
3) one M and one S gene who does not smoke
4) one M gene and one S gene who does smoke
5) two M genes who does not smoke
6) two S genes who does not smoke
Chapter 5 Solutions
Genetics: Analysis and Principles
Ch. 5.1 - A female snail that coils to the left has...Ch. 5.1 - 2. What is the molecular explanation for maternal...Ch. 5.2 - 1. In fruit flies, dosage compensation is achieved...Ch. 5.2 - 2. According to the Lyon hypothesis,
a. one of...Ch. 5.2 - Prob. 3COMQCh. 5.3 - 1. In mice, the copy of the Igf2 gene that is...Ch. 5.3 - 2. A female mouse that is is crossed to a male...Ch. 5.3 - Prob. 3COMQCh. 5.3 - Prob. 4COMQCh. 5.4 - 1. Extranuclear inheritance occurs due to
a....
Ch. 5.4 - 2. A cross is made between a green four-o’clock...Ch. 5.4 - 3. Some human diseases are caused by mutations in...Ch. 5.4 - 4. Chloroplasts and mitochondria evolved from an...Ch. 5 - Define the term epigenetic inheritance, and...Ch. 5 - 2. Describe the inheritance pattern of maternal...Ch. 5 - A maternal effect gene exists in a dominant N...Ch. 5 - 4. A Drosophila embryo dies during early...Ch. 5 - 5. For Mendelian inheritance, the nuclear genotype...Ch. 5 - Suppose a maternal effect gene exists as a...Ch. 5 - Suppose that a gene affects the anterior...Ch. 5 - Explain why maternal effect genes exert their...Ch. 5 - As described in Chapter 22, researchers have been...Ch. 5 - 10. With regard to the numbers of sex chromosomes,...Ch. 5 - 11. What is a Barr body? How is its structure...Ch. 5 - Among different species, describe three distinct...Ch. 5 - 13. Describe when X-chromosome inactivation occurs...Ch. 5 - 14. Describe the molecular process of X-chromosome...Ch. 5 - Prob. 15CONQCh. 5 - 16. How many Barr bodies would you expect to find...Ch. 5 - 17. Certain forms of human color blindness are...Ch. 5 - A black female cat (XBXB) and an orange male cat...Ch. 5 - Prob. 19CONQCh. 5 - When does the erasure and reestablishment phase of...Ch. 5 - In what types of cells would you expect de novo...Ch. 5 - 22. On rare occasions, people are born with a...Ch. 5 - Genes that cause Prader-Willi syndrome and...Ch. 5 - Prob. 24CONQCh. 5 - What is extranuclear inheritance? Describe three...Ch. 5 - Prob. 26CONQCh. 5 - Among different species, does extranuclear...Ch. 5 - Extranuclear inheritance often correlates with...Ch. 5 - Prob. 29CONQCh. 5 - Prob. 30CONQCh. 5 - Which of the following traits or diseases is (are)...Ch. 5 - Prob. 32CONQCh. 5 - 33. Describe how a biparental pattern of...Ch. 5 - Figure 5.1 describes an example of a maternal...Ch. 5 - 2. Discuss the types of experimental observations...Ch. 5 - Prob. 3EQCh. 5 - As a hypothetical example, a trait in mice results...Ch. 5 - You have a female snail that coils to the right,...Ch. 5 - Prob. 6EQCh. 5 - 7. Figure 5.6 describes the results of...Ch. 5 - Prob. 8EQCh. 5 - In the experiment of Figure 5.6, why does a clone...Ch. 5 - Prob. 10EQCh. 5 - 11. A variegated trait in plants is analyzed using...Ch. 5 - 1. Recessive maternal effect genes are identified...Ch. 5 - Prob. 2QSDC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What are the possible genotypes of the PTC locus?arrow_forwardName any two diseases for which transgenic mice are used as model organisms.arrow_forwardBelow is a figure (here called Figure 1) from “Prognostic Significance of CpG Island Methylator Phenotype and Microsatellite Instability in Gastric Carcinoma,” by An et al., published in Clinical Cancer Research in 2005. The authors look at five microsatellite loci (BAT 25, BAT 26, D2S123, D5S346, and D17S250) in normal (N) and tumor (T) tissue from patients with Gastric Carcinoma. They amplify the loci by PCR and then instead of using standard agarose gel electrophoresis, they run the PCR products through capillary gel electrophoresis and detect bands as they pass a laser near the positive charge terminal. The x-axis in these plots is the time at which the band passed the laser (aka size of the PCR product) and the intensity of the peaks represents the amount of DNA in that band A. Which patient- 18, 30, or 1- shows the most microsatellite instability? Which patient shows the least? How do you know? B. In which repair pathway is it most likely that you will find the driver mutations…arrow_forward
- The p53 protein was discovered through its association with SV40 T antigen and assumed initially to be an oncoprotein. a. What is the current consensus as the function of p53 and what evidence caused this change in view? b. How does the effect of mutation in the p53 gene differ from the effect of mutation in the RB gene what is the molecular basis for this difference ?arrow_forwardDetermine the map distances between the genes.arrow_forwardA wild-type mouse that is heterozygous for two immunoglobulin heavy chain alleles (IgHa/b) generates the population of B cells shown on the left of the figure below. A mouse strain, also IgHa/b, carries an inactivating mutation in the VpreB gene. In addition to producing fewer mature B cells than the wild-type mice, the VpreB-deficient mice generate B cells as shown on the right. What is the explanation of the difference seen between the wild-type and the VpreB-mutant B cells?arrow_forward
- the topic is Identification of Differentially Expressed Genes in Breast Cancer Using RNA-Seq write a method section of a scientific report for this topic. including the use of excel to get these result( will be included in the images) and also this website https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE216238arrow_forwardExplain how site directed mutagenesis can be accomplished using M13 bacteriophage. Using this method often results in only 5% of plaques with mutant gene. Explain how the procedure has been modified to enrich for the number of plaques with the mutant gene.arrow_forwardA RFLP is discovered that is linked to the gene for Duchenne’s muscular dystrophy (DMD). DMD is an X-linked, recessive trait. The RFLP is 2 map units from the gene for DMD. Consider the following pedigree and Southern blot using a probe that hybridizes to the RFLP. Which band/s is/are associated with DMD? What is the genotype for individuals 3 and 4? (Remember, this is an X linked disease, so use X’s and Y’s to denote). Individual 9 married a man who does NOT have muscular dystrophy, and she is pregnant. DMD is an X-linked trait. What is the probability for their child to have DMD? An amniocentesis is performed and it is determined that 9’s child in utero has only a 10 kb band that hybridizes to the same probe used above. What can you say about the child now?arrow_forward
- A research group is studying a bacterium X that binds to mucosal cells in the lung and invades. Wildtype X has an LD50 value of 10 bacteria when administered to mice by inhalation. Using transposon mutagenesis, the researchers have isolated two mutants of X that they call Xmut1 and Xmut2, both of which have LD50 values of 105 when inhaled by mice. However, in tissue culture cells, Xmut1 can invade the cells just as well as wild-type X, while Xmut2 cannot. Provide a possible explanation for these results.arrow_forwardWhen the S.cerevisiae genome was sequenced and surveyed for possible genes, only about 40% of those genes had been previously identified in forward genetic screens. This left about 60% of predcited genes with no known function, leading some to dub the genes fun (function unknown) genes. a)As an approach to understanding the function of a certain fun gene, you wish to create a loss of function allele. How would you do this? b)You wish to know the physical location of the encoded protein product. How would you obtain such information?arrow_forwardUsing the information provided below, which of the individuals A and B have: i) Genotypic change ii) Phenotypic change iii) Genotypic and phenotypic change X is the partial CDNA sequence of the normal CFTR gene. Use this to determine which DNA sequence (A &B) is the DNA extracted from a patient with and without disease. X) ATGGCGGTCACTCGGCAATTTCCCTGGGCTGTACAAACATGGTATGACTCTCTTGGAGCAATAAACA Met. A V IR Q F P WA V Q T W Y D S L GAI .. A) ATGGCGGTCACTCGGCAATTTCCCTGGGCTGTACAAACAGGTATGACTCTCTTGGAGCAATAAACAA Met. B) ATGGCGGTCACTCGGCAATTTCCCTGGGCTGTACAAACTTGGTATGACTCTCTTGGAGCAATAAACA Met. Since this is a complementary DNA (CDNA) The nucleotide "T" can be directly replaced with U to get the mRNA strand. Example: ATG is AUG, TCA is UCA etc Second letter G UAU UCU c Phe UCc UGU UUC U UUA UAC JTyr UGCCYS Ser UCA UCG UAA Stop UGA Stop A UAG Stop UGG Trp UUG Leu G. CUU CCU CCC Pro CAU CAC Hi. CAA CAGJ CGU CGC CUC CUA Leu CCA Arg CGA Gin CUG CCG CGG AUU ACU ACC ACA AUG Met ACG LAsn AGUser AAC AUC…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY