
Concept explainers
To determine:
The three general type of epithelial cells
Introduction:
There are four types of tissue present in animals: epithelial tissue, muscle tissue, connective tissue and nerve tissue. These tissues have several modifications depending on the location and function. Epithelial tissue not only forms the outer lining of the body but it also forms the outer covering of organs and the body cavity.
To determine:
The general functions and structures of epithelial tissue.
Introduction:
Epithelial cells generate from all three germ layers that is from ectoderm, mesoderm and endoderm. These cells can be dead and keratinized, like the cells present in the skin. Cells can also be living like the epithelial cells present in outer lining of the organs. So there are different classes of epithelium cells depending on location and function.

Want to see the full answer?
Check out a sample textbook solution
Chapter 32 Solutions
Biology: Life on Earth with Physiology (11th Edition)
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College





