
Biology: Life on Earth with Physiology (11th Edition)
11th Edition
ISBN: 9780133923001
Author: Gerald Audesirk, Teresa Audesirk, Bruce E. Byers
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 32, Problem 2MC
Summary Introduction
Introduction:
Animals are divided into two categories based on their capacity to regulate body temperature by metabolic process: ectotherm and endotherm. During the break down of food at the cellular level, energy and heat are generated. In certain organisms, the heat generated helps them to regulate their body temperature, while in others the heat generated is in small quantity and hence, does not have much contribution in maintaining the body temperature of the organism.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 32 Solutions
Biology: Life on Earth with Physiology (11th Edition)
Ch. 32.1 - Prob. 1CSCCh. 32.1 - define homeostasis and explain why organisms...Ch. 32.1 - Prob. 1HYEWCh. 32.1 - What would happen if a cold, shvering mammal...Ch. 32.1 - Prob. 2CSCCh. 32.1 - explain the difference between ectotherms and...Ch. 32.1 - Prob. 3CYLCh. 32.1 - Prob. 4CYLCh. 32.2 - Prob. 1CSRCh. 32.2 - By pumping carbon dioxide and other greenhouse...
Ch. 32.2 - Prob. 1CYLCh. 32.2 - Prob. 1ETCh. 32.2 - describe the four types of tissues?Ch. 32.2 - name and describe the major human organ systems?Ch. 32 - Why does life on land present particular...Ch. 32 - The ability of the body to maintain its internal...Ch. 32 - Which of the following statements is False? a....Ch. 32 - Define homeostasis, and explain how negative...Ch. 32 - Prob. 2ACCh. 32 - Prob. 2FIBCh. 32 - Prob. 2MCCh. 32 - Define and compare ectotherms and endotherms....Ch. 32 - Imagine you are a health care professional...Ch. 32 - Prob. 3FIBCh. 32 - Prob. 3MCCh. 32 - Prob. 3RQCh. 32 - Glands with ducts connecting them to the...Ch. 32 - Prob. 4MCCh. 32 - Prob. 4RQCh. 32 - Prob. 5FIBCh. 32 - Which of the following statements is True? a....Ch. 32 - Prob. 5RQCh. 32 - what property distinguishes connective tissue from...Ch. 32 - Prob. 7RQ
Knowledge Booster
Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
