
Concept explainers
To describe:
The threats of habitat destruction, overexploitation, invasive species, pollution, and global climate change.
Introduction:
Biodiversity is a habitat where entire living organism lives together. It is of three types: species biodiversity, genetic biodiversity, and ecosystem biodiversity.
Habitat destruction, overexploitation, invasive species, pollution, and global climate change are the threats to biodiversity.
Habitat destruction occurs due to human activities like urbanization, deforestation, and overhunting; due to these activities species lose their habitat.
Overexploitation occur when humans start over harvesting the species; for example, over hunting and over fishing,
Invasive species are not native to the ecosystem and cause harm to other existing species are called invasive species; it can be anything plant, insects, or fish.
Pollution it is of many types; for example, soil pollution, air pollution, and water pollution. It is caused by humans and affects biodiversity.
Global climate change occurs due to overharvesting of species, and pollution, ecosystem starts to imbalance, which cause changes in the climate called global climate change.

Want to see the full answer?
Check out a sample textbook solution
Chapter 31 Solutions
Biology: Life on Earth with Physiology (11th Edition)
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning




