Biology: Life on Earth with Physiology (11th Edition)
11th Edition
ISBN: 9780133923001
Author: Gerald Audesirk, Teresa Audesirk, Bruce E. Byers
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 31.5, Problem 1CSC
Summary Introduction
To describe:
Wildlife corridor, include private land and interspersed between national parks and national forests, can landowners preserve wildlife habitat while still making a living and enjoying their land.
Introduction:
Wildlife corridors allow the movement of animal in protective manner from one place to another place. It is important because it allow animals to maintain their habitat and genetic diversity. These corridors interspersed between private land and national parks and forest so it is taking some space of private land but, an individual can make different way, for example they can make bridges or underground subway so that animal can pass without any disturbance.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Name two reasons that a large national park like Serengeti or Yellowstone might not be enough to effectively conserve a population of a threatened species. What solutions exist to address these reasons?
Bighorn sheep are an iconic species in the western United States, however, their
population size is drastically lower than it once was historically. These sheep inhabit
montane patches surrounded by urban and agricultural landscapes. Accordingly,
bighorn sheep can be considered a metapopulation. Wildlife managers would like to
increase the patch occupancy of bighorn sheep. Which of the following would be the
most effective conservation/restoration strategy?
None of these statements is an effective conservation strategy.
O Increase patch size and quality, and decrease the distance between patches.
O Increase patch size and the distance between patches, and decrease patch
quality.
O Increase the distance between patches and patchy quality, and decrease patch
size.
Decrease patch size, distance between patches, and patch quality.
Explain the immediate and secondary effects or removing others from a kelp forest ecosystem.
In your response, use the word: keystone species, biodiverse/biodiversity
USE THIS SETENCE STARTER:
the immediate effect of removing otters from the ecosystem is...
The secondary effect of removing otters from the ecosystem is...
Chapter 31 Solutions
Biology: Life on Earth with Physiology (11th Edition)
Ch. 31.1 - describe the goals of conversation biology?Ch. 31.1 - Prob. 2CYLCh. 31.2 - Prob. 1CSCCh. 31.2 - describe the major categories of ecosystem...Ch. 31.2 - Prob. 1TCCh. 31.2 - Prob. 2CYLCh. 31.3 - define mass extinction?Ch. 31.3 - Prob. 1HYEWCh. 31.3 - explain why biologists fear that a mass extinction...Ch. 31.4 - Prob. 1CSC
Ch. 31.4 - Prob. 1CYLCh. 31.4 - Prob. 1TCCh. 31.4 - Prob. 2CYLCh. 31.5 - Prob. 1CSCCh. 31.5 - Prob. 1CYLCh. 31.5 - Prob. 1TCCh. 31.5 - Prob. 2CYLCh. 31.6 - Before 1700, wolves roamed over almost all of...Ch. 31.6 - describe the principles of sustainable...Ch. 31.6 - In 1970, Atlantic leatherback sea turtle...Ch. 31.6 - explain how population, technology, and lifestyle...Ch. 31 - List some reasons that the ecological footprints...Ch. 31 - Prob. 1FIBCh. 31 - A factor that increases humanity ecological...Ch. 31 - Prob. 1RQCh. 31 - Search for and describe some examples of habitat...Ch. 31 - Prob. 2FIBCh. 31 - Prob. 2MCCh. 31 - What is ecological economics? Why is it important?Ch. 31 - Prob. 3FIBCh. 31 - Prob. 3MCCh. 31 - Prob. 3RQCh. 31 - Prob. 4FIBCh. 31 - Prob. 4MCCh. 31 - Prob. 4RQCh. 31 - The smallest population of a species that is...Ch. 31 - Which of the following is not true of a population...Ch. 31 - Why are efforts to protect monarch butterflies a...Ch. 31 - A Native American saying tells us that We do not...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Hunting is banned in all national parks but not outside of them. During bear hunting season, conservation officers conduct routine checks. One day, the OPP receive a report from campers that they heard shots fired inside Algonquin National Park. The OPP transmits this information to the Natural Resources office. Based on the campers' tip, check points are set up on the highway through Huntsville. All of the hunters that bring bears past the checkpoint have licenses, but in order to check out the camper's story several hairs are pulled from each carcass for DNA checks. The data below shows DNA containing two STR regions for the bear carcasses that were examined on the day after the campers' complaint, and two known reference samples of bear sub-populations around Huntsville, including inside the park. POSSIBLE POACHER'S DNA DATA Reference #1: Genotype Indigenous to Park TCAGGGACGACGACGACGACGACGACCCATTATCGGAGTTATTATTAGATCGATCCATTCGGATCGGATAT Reference #2: Genotype Indigenous to Park…arrow_forwardDescribe two of the threats facing native species at Hakalau Forest NWR or elsewhere in Hawai‘i, and two actions people have taken to address these threats. What new trend is now jeopardizing some of these efforts? What steps do you think might be required in the future to safeguard native species, populations, and communities in mountainous habitats in places like Hawai‘i?arrow_forwardIn many cases, circumstances prevent preservation of a large, unbroken area of a threatened species’ habitat. Sometimes, however, several smaller areas can be protected. In such cases, conservation biologists stress that the small areas must be linked by corridors of the appropriate habitat. Can you explain why?arrow_forward
- Environmental scientists David Pimentel, Rodolfo Zuniga, and Doug Morrison of Cornell University reviewed scientific estimates for the economic and ecological costs imposed by introduced and invasive species in the United States. They found that, as of 2005, approximately 50,000 species had been introduced in the United States and that these accountedfor over $120 billion in economic costs each year. These costs include direct losses and damage, as well as costs required to control the species. (The researchers did not quantify monetary estimates for losses of biodiversity, ecosystem services, and aesthetics, which they said would drive total costs several times higher.) Calculate values missing from the table to determine the number of introduced species of each type of organism and the annual cost that each imposes on our economy. Of the 50,000 species introduced into the UnitedStates, half are plants. Describe two ways in whichnon-native plants might be brought to a new location.How…arrow_forwardWhich of the following could qualify as a bottom-up control on a grassland community? (A) limitation of plant biomass by rainfall amount, (B) effect of grazing intensity by bison on plant species diversity, (C) the effects of predation by wolves on herbivore density, (D) herbivory by moth larvae reducing abundances of certain plant species, (E) agricultural practices by humans eliminating all but one species of grass.arrow_forwardWhat are the implications of the "bottleneck effect" for wildlife managers who try to help endangered species, such as the whooping crane, recover from near extinction?arrow_forward
- Exotic or non-indigenous species are species that have been transported to new locations by humans, either intentionally (e.g., the ornamental trade, fisheries or aquaculture) or unintentionally (e.g., accidental release of aquarium or pet species), and have established one or more populations in their new location. Exotic species may become invasive species if they expand their range in their novel region and become abundant. The presence of invasive species is of concern because invasive species can have negative effects on the affected ecosystems or commercial interest. Research an invasive species and include the following: Scientific name and common name (if the species has one) The species native region and invaded region Consequences or concerns that the species presents. Potential solutions Include referencesarrow_forwardThe Endangered Species Act (ESA) requires a 5-year post-delisting monitoring process to be followed when a species is delisted from the ESA due to recovery. According to the NOAA Fisheries (n.d.) the gray whale population in the Eastern North Pacific, known as the Distinct Population Segment (DPS), was recognized as endangered under the Endangered Species Act (ESA) in 1970. In 1994, it was a significant milestone when the Eastern North Pacific DPS was removed from the endangered list and declared as a recovered population. The monitoring plan, A 5- YEAR PLAN FOR RESEARCH AND MONITORING OF THE EASTERN NORTH PACIFIC POPULATION OF GRAY WHALES.provided by the NOAA can be found in the citation: United States, National Marine Fisheries Service., Gray Whale Monitoring Task Group, (1993). A 5-year Plan for Research and Monitoring of the Eastern North Pacific Population of Gray Whales. NOAA. https://repository.library.noaa.gov/view/noaa/3511 Use this 5 year recovery plan on gray whales to…arrow_forwardWhich of the following best predicts the consequences of introducing brown rats ( invasive species) to an island where they did not previously exist? Choose 1 answer: Choose 1 answer: (Choice A) A The rat population size will likely remain small, and as a result the rats will not be able to outcompete other organisms for resources. (Choice B) B Without its typical food sources, the rat population will not be able to become established, and the island ecosystem will remain stable. (Choice C) The rat population will grow rapidly, disrupting the island's community structure by feeding on native plants and animals. (Choice D) D Without any natural predators, the rat population will become established and help increase the species diversity of the island answer explainarrow_forward
- Buffer zones in a conservation program are: O a. Areas in which the original habitat has been replanted. O b. Areas from which humans are excluded. O c. Areas in which there is no increase in farm land. O d. Areas in which there is no hunting or logging. Areas in which there are no types of industries. O e.arrow_forwardFirst, here are UNESCO's Biosphere Reserve and World Heritage programs. https://en.unesco.org/node/314143 Using the information in the link above, answer the following questions: Refer to this page on their website: https://en.unesco.org/biosphere/eu-na 4. How many Biosphere Reserves are currently in the United States? 5. How many have been withdrawn by the U.S. since 2016? 6. In 75-100 words (your own) describe the World Heritage Site program. https://whc.unesco.org/en/about/arrow_forwardWhich one of these statements about COSEWIC is false? COSEWIC's assessments take into account political, social and economic factors. The Species at Risk Act (2002) established COSEWIC as an advisory body. The committee made its first designation in April 1978 and has met annually since then. Members of COSEWIC are wildlife biology experts from academia, government, non-governmental organizations and the private sector responsible for designating wildlife species in danger of disappearing from Canada.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning