
Prescott's Microbiology
10th Edition
ISBN: 9781259281594
Author: Joanne Willey, Linda Sherwood Adjunt Professor Lecturer, Christopher J. Woolverton Professor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 27.5, Problem 1MI
Where in the host does the plus-strand RNA genome replicate?
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 27 Solutions
Prescott's Microbiology
Ch. 27.1 - List some characteristics used in classifying...Ch. 27.1 - Consider these terms: Equine torovirus,...Ch. 27.2 - What enzyme found in the T4 baseplate facilitates...Ch. 27.2 - Why do you think T4 evolved to initiate DNA...Ch. 27.2 - What function does HMC glycosylation serve?Ch. 27.2 - How is the envelope of this virus formed? How does...Ch. 27.2 - Explain why the T4 genome is circularly permuted.Ch. 27.2 - Prob. 1.2RIACh. 27.2 - How is a prophage induced to become active again?Ch. 27.2 - Describe the roles of cII, CIII, repressor (CI),...
Ch. 27.2 - How do the temperate phages Mu and P1 differ from...Ch. 27.2 - The CRISPR/Cas system has been a boon to...Ch. 27.2 - Why do cold sores recur throughout the lifetime of...Ch. 27.2 - In what part of the host cell does a herpesvirus...Ch. 27.2 - Many small DNA viruses rely on host enzymes for...Ch. 27.3 - Why is the X174 genome considered plus stranded?Ch. 27.3 - Prob. 2MICh. 27.3 - Why is it necessary for some ssDNA viruses to...Ch. 27.3 - From the point of view of the virus, compare the...Ch. 27.3 - How do parvoviruses trick the host DNA polymerase...Ch. 27.4 - The rotavirus genome encodes 12 proteins. Suggest...Ch. 27.4 - Describe the life cycle of 6 phage. What makes...Ch. 27.4 - Prob. 3RIACh. 27.4 - In what ways are the life cycles of 6 and...Ch. 27.5 - Where in the host does the plus-strand RNA genome...Ch. 27.5 - How do some plus-strand viruses use polyproteins...Ch. 27.5 - What is an IRES? Why is it important?Ch. 27.5 - Prob. 3RIACh. 27.6 - How does that use of a segmented genome by...Ch. 27.6 - Prob. 2RIACh. 27.7 - Prob. 1MICh. 27.7 - Prob. 1RIACh. 27.7 - Prob. 2RIACh. 27.7 - What role does alternative splicing play in the...Ch. 27.8 - Prob. 1RIACh. 27.8 - Trace the HBV multiplication cycle, paying...Ch. 27 - No temperate RNA phages have yet been discovered....Ch. 27 - The choice between lysogeny and lysis is...Ch. 27 - Prob. 3CHICh. 27 - You are studying RNA viruses and have discovered a...Ch. 27 - Prob. 5CHICh. 27 - Upon infection of host epithelial cells,...Ch. 27 - Associated with the envelope of herpesviruses are...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Surgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:CengageBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningPrinciples Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
Surgical Tech For Surgical Tech Pos Care
Health & Nutrition
ISBN:9781337648868
Author:Association
Publisher:Cengage

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning


Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning
genetic recombination strategies of bacteria CONJUGATION, TRANSDUCTION AND TRANSFORMATION; Author: Scientist Cindy;https://www.youtube.com/watch?v=_Va8FZJEl9A;License: Standard youtube license