EBK SEELEY'S ANATOMY & PHYSIOLOGY
11th Edition
ISBN: 9781259671166
Author: VanPutte
Publisher: MCGRAW HILL BOOK COMPANY
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 2.4, Problem 55AYP
Summary Introduction
To determine:
The meaning of the given statement “DNA strands are antiparallel.”
Introduction:
Deoxyribonucleic acid (DNA) is known as the genetic material of living cells. DNA contains the genetic information, which gets transmitted from one generation to the next generation of the cells.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
In a segment of DNA consisting of 1000 nitrogen bases, 28% of which are thymine, how many bases are adenine, guanine, and cytosine?
In a single strand of DNA, is it ever possible for the number of adenines to be greater than the number of thymines? Describe
For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’
Write:
a) the sequence of the complementary DNA strand
Chapter 2 Solutions
EBK SEELEY'S ANATOMY & PHYSIOLOGY
Ch. 2.1 - Define matter. How are the mass and the weight of...Ch. 2.1 - Differentiate between element and atom. What four...Ch. 2.1 - Prob. 3AYPCh. 2.1 - Which subatomic particle determines the atomic...Ch. 2.1 - What is an isotope? How are isotopes denoted?Ch. 2.1 - What is avogardro’s number? How is it related to a...Ch. 2.1 - Describe how an ionic bond is formed. What are...Ch. 2.1 - What occurs in the formation of a covalent bond?...Ch. 2.1 - Distinguish between a molecule and a compund. Give...Ch. 2.1 - What are intermolecular forces, and how do they...
Ch. 2.1 - What is meant by the statement “table sugar is...Ch. 2.1 - Describe what occurs during the dissociation of...Ch. 2.1 - Explain the difference between electrolytes and...Ch. 2.2 - Using the terms reactant and product, describe...Ch. 2.2 - Contrast synthesis and decomposition reactions,...Ch. 2.2 - Describe the role of water in dehydration and...Ch. 2.2 - What is a reversible reaction? How does this type...Ch. 2.2 - What are oxidation-reduction reactions?Ch. 2.2 - Define energy. How are potential and kinetic...Ch. 2.2 - Summarize the characteristics of mechanical,...Ch. 2.2 - Use ATP and ADP to Illustrate the release or input...Ch. 2.2 - Define activation energy, catalyst, and enzymes;...Ch. 2.2 - What effect does increasing temperature or...Ch. 2.3 - What is the difference between inorganic and...Ch. 2.3 - What two properites of water are the result of...Ch. 2.3 - List and briefly describe the four functions that...Ch. 2.3 - Prob. 27AYPCh. 2.3 - Prob. 28AYPCh. 2.3 - Prob. 29AYPCh. 2.3 - Prob. 30AYPCh. 2.3 - Prob. 31AYPCh. 2.3 - Prob. 32AYPCh. 2.3 - Prob. 33AYPCh. 2.3 - Prob. 34AYPCh. 2.3 - What are the functions of oxygen and carbon...Ch. 2.4 - Prob. 36AYPCh. 2.4 - Prob. 37AYPCh. 2.4 - Prob. 38AYPCh. 2.4 - Prob. 39AYPCh. 2.4 - Which carbohydrates are used for energy? What is...Ch. 2.4 - Prob. 41AYPCh. 2.4 - Prob. 42AYPCh. 2.4 - Prob. 43AYPCh. 2.4 - Prob. 44AYPCh. 2.4 - Prob. 45AYPCh. 2.4 - Prob. 46AYPCh. 2.4 - What are the building blocks of proteins? What...Ch. 2.4 - Prob. 48AYPCh. 2.4 - Prob. 49AYPCh. 2.4 - Compare the lock-and-key and the induced fit...Ch. 2.4 - Prob. 51AYPCh. 2.4 - What are the basic building blocks of nucleic...Ch. 2.4 - DNA is like a twisted ladder. What forms the sides...Ch. 2.4 - Prob. 54AYPCh. 2.4 - Prob. 55AYPCh. 2.4 - Prob. 56AYPCh. 2.4 - Prob. 57AYPCh. 2 - Prob. 1RACCh. 2 - Prob. 2RACCh. 2 - Prob. 3RACCh. 2 - Prob. 4RACCh. 2 - Table salt (NaCl) is an atom organic. a molecule....Ch. 2 - Prob. 6RACCh. 2 - Prob. 7RACCh. 2 - Prob. 8RACCh. 2 - Prob. 9RACCh. 2 - Prob. 10RACCh. 2 - Prob. 11RACCh. 2 - Which of these statements concerning enzymes is...Ch. 2 - Prob. 13RACCh. 2 - Prob. 14RACCh. 2 - Prob. 15RACCh. 2 - Prob. 16RACCh. 2 - A buffer slows down chemical reactions. speeds up...Ch. 2 - Prob. 18RACCh. 2 - Prob. 19RACCh. 2 - Prob. 20RACCh. 2 - Prob. 21RACCh. 2 - Prob. 22RACCh. 2 - Prob. 23RACCh. 2 - DNA molecules conatin genes. contain a single...Ch. 2 - Prob. 25RACCh. 2 - Prob. 1CTCh. 2 - Prob. 2CTCh. 2 - A mixture of chemicals is warmed slightly. As a...Ch. 2 - Two solutions, when mixed together at room...Ch. 2 - Prob. 5CTCh. 2 - Prob. 6CTCh. 2 - Carbon dioxide that accumulates in the blood can...Ch. 2 - An enzyme (E) catalyzes the following reaction:...Ch. 2 - Using the materials commonly found in a kitchen,...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- If the DNA sequence A-T-T-G-G-C-C-T-A on an informational strand mutated and became A-C-T-G-G-C-C-T-A, what effect would the mutation have on the sequence of the protein produced?arrow_forwardshow the structure for nucleosides of DNA:arrow_forwardWrite the sequence of the complementary DNA strand thatpairs with each of the following DNA base sequences:(a) GGTTAC(b) CCCGAAarrow_forward
- What type of DNA helix spirals to the left and the backbone takes on a zigzag shape?arrow_forwardHow many combinations of DNA bases are for a polynucleotide of 7 base pairs in length?arrow_forwardWhat is the sequence of amino acids coded by the following sequence of nucleotides on a strand of DNA from the 5' to 3' end? A - T - C - G - C - T - A - C - G - A - A - T How many nucleotides are there?arrow_forward
- What sequence of bases on one strand of DNA (reading in the 3′ to 5′ direction) is complementary to the sequence 5′ T-A-T-G-C-A-G 3′ on the other strand?arrow_forwardOne DNA chain of a DNA double helix contains 18% A, 35% T, 28% C, and 21% G. What is the composition of the complementary DNA chain?arrow_forwardList the DNA bases that will complementary base pair with the following sequence: A-G-C-T-A-C-Garrow_forward
- In what ways are the structures of an α helix in a protein and thedouble helix of DNA similar, and in what ways are theydifferent?arrow_forwardIf a DNA double helix contains 28% T nucleotides, then what is the percentage of A nucleotides?arrow_forwardIf the sequence of one strand of a DNA molecule is 5’-AGCCCCGACTCTATTC-3’, what is the sequence of the complementary strand?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY