
What are the four main organs of the urinary system?

To review:
The four main organs that are a part of the urinary system.
Introduction:
The organs of the urinary system perform the function ofremoval of metabolic wastesas well as water from the body. It cleans the waste substances of the body. It also removes toxins, produces erythrocytes, and maintainshomeostasis by regulating the blood pressure.
Explanation of Solution
The urinary system consists of paired kidneys and the urinary tract. The four main organs of the urinary system are given as follows:
1. Kidney: Kidneys are the specialized paired organs that filter the blood to remove metabolic wastes as well as also modify the resulting fluid. Thus, they regulate the amount of fluid, electrolyte, the balance of acid–base, and blood pressure of the body. Kidney also performs endocrine functions by secreting hormones.
2. Ureters: Uretersare the hollow tubes that serve the purpose of transporting urine from kidneys. These are about 25–30 cm (centimeter)in length and 3–4mm (millimeter) in diameters in case of an adult. They are made up of three layers: adventitia, muscular, and mucosa. They run along the posterior wall of the body and connect the kidneys to the urinary bladder.
3. Urinary bladder: It is a hollow, sac-like anddistensiblemuscular organ that resides on the floor of the pelvic cavity. It is suspended througha fold of parietal layer of peritoneum membrane. It crumbles when it is empty, but when dilated, it can stretch its muscles. Then it can hold up to about 700–800ml (milliliter) of urine. It is connected to the ureters and stores urine.
4. Urethra: Urethra is connected to the bladder and forms the terminal portion of the urinary tract. It releases the urine from the bladder toward outside of the body. The urethra is different in males and females. It is shorter in females (about 4 cm in length) and opens in between vagina and clitoris. In males, it is longer (about 20 cm in length) and transports both urines as well as semen.
Thus, it can be concluded that the four major structures of the urinary system areureters, kidneys, urinary bladder, as well as urethra. Kidneys perform the work of removing the metabolic wastes from the blood and produce urine. The other organs facilitate storage and expulsion of urine.
Want to see more full solutions like this?
Chapter 24 Solutions
Human Anatomy & Physiology
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningPrinciples Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning


