Anatomy & Physiology: The Unity of Form and Function
9th Edition
ISBN: 9781260791563
Author: Kenneth S. Saladin
Publisher: Mcgraw-hill Higher Education (us)
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 21.3, Problem 13AYLO
Summary Introduction
To discuss:
The necessity of antigen-presenting cells (APCs) to immunity; cell types that serve as APCs; the mechanism of antigen processing; and the role of MHC proteins in antigen presentation.
Introduction:
Antigen presenting cells are a group of immune cells, which involves in the cellular immune response. They play a role in presenting and processing an antigen for recognition by the T cells.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 21 Solutions
Anatomy & Physiology: The Unity of Form and Function
Ch. 21.1 - Prob. 1BYGOCh. 21.1 - Prob. 2BYGOCh. 21.1 - Prob. 3BYGOCh. 21.1 - Prob. 4BYGOCh. 21.1 - Prob. 5BYGOCh. 21.1 - Prob. 1AYLOCh. 21.1 - Prob. 2AYLOCh. 21.1 - Prob. 3AYLOCh. 21.1 - Prob. 4AYLOCh. 21.1 - Prob. 5AYLO
Ch. 21.1 - Prob. 6AYLOCh. 21.1 - Prob. 7AYLOCh. 21.1 - The nature of diffuse lymphatic tissue and where...Ch. 21.1 - Prob. 9AYLOCh. 21.1 - Prob. 10AYLOCh. 21.1 - Prob. 11AYLOCh. 21.1 - Prob. 12AYLOCh. 21.1 - Prob. 13AYLOCh. 21.1 - Prob. 14AYLOCh. 21.1 - Location, gross anatomy, and histology of the...Ch. 21.2 - Prob. 6BYGOCh. 21.2 - Prob. 7BYGOCh. 21.2 - How do interferons and the complement system...Ch. 21.2 - Prob. 9BYGOCh. 21.2 - List the cardinal signs of inflammation and state...Ch. 21.2 - Prob. 1AYLOCh. 21.2 - Prob. 2AYLOCh. 21.2 - Differences between innate and adaptive immunity;...Ch. 21.2 - Prob. 4AYLOCh. 21.2 - Prob. 5AYLOCh. 21.2 - Prob. 6AYLOCh. 21.2 - The one type of lymphocyte that is involved in...Ch. 21.2 - Types of macrophages; their origin and functionsCh. 21.2 - Prob. 9AYLOCh. 21.2 - Prob. 10AYLOCh. 21.2 - Prob. 11AYLOCh. 21.2 - Prob. 12AYLOCh. 21.2 - Prob. 13AYLOCh. 21.2 - Prob. 14AYLOCh. 21.2 - Prob. 15AYLOCh. 21.2 - Prob. 16AYLOCh. 21.2 - Examples of inflammatory cytokines and their rolesCh. 21.2 - How hyperemia, bradykinin, and other factors...Ch. 21.2 - Prob. 19AYLOCh. 21.2 - Prob. 20AYLOCh. 21.2 - Prob. 21AYLOCh. 21.3 - Prob. 11BYGOCh. 21.3 - Prob. 12BYGOCh. 21.3 - Contrast active and passive immunity. Give natural...Ch. 21.3 - Prob. 14BYGOCh. 21.3 - Prob. 15BYGOCh. 21.3 - Prob. 16BYGOCh. 21.3 - Prob. 17BYGOCh. 21.3 - Prob. 18BYGOCh. 21.3 - Prob. 1AYLOCh. 21.3 - Prob. 2AYLOCh. 21.3 - How adaptive immunity is classified as active or...Ch. 21.3 - Prob. 4AYLOCh. 21.3 - Prob. 5AYLOCh. 21.3 - Prob. 6AYLOCh. 21.3 - Prob. 7AYLOCh. 21.3 - Prob. 8AYLOCh. 21.3 - Prob. 9AYLOCh. 21.3 - Prob. 10AYLOCh. 21.3 - The meanings of immunocompetence and...Ch. 21.3 - Prob. 12AYLOCh. 21.3 - Prob. 13AYLOCh. 21.3 - Prob. 14AYLOCh. 21.4 - Prob. 19BYGOCh. 21.4 - Prob. 20BYGOCh. 21.4 - Prob. 21BYGOCh. 21.4 - Prob. 22BYGOCh. 21.4 - Prob. 1AYLOCh. 21.4 - Prob. 2AYLOCh. 21.4 - Prob. 3AYLOCh. 21.4 - Prob. 4AYLOCh. 21.4 - Prob. 5AYLOCh. 21.4 - How activated Tc cells destroy target cells; the...Ch. 21.4 - Prob. 7AYLOCh. 21.5 - Prob. 23BYGOCh. 21.5 - Prob. 24BYGOCh. 21.5 - Prob. 25BYGOCh. 21.5 - Similarities and differences between humoral and...Ch. 21.5 - Prob. 2AYLOCh. 21.5 - Prob. 3AYLOCh. 21.5 - Prob. 4AYLOCh. 21.5 - Prob. 5AYLOCh. 21.6 - Prob. 26BYGOCh. 21.6 - Prob. 27BYGOCh. 21.6 - Prob. 28BYGOCh. 21.6 - Prob. 29BYGOCh. 21.6 - Prob. 30BYGOCh. 21.6 - Prob. 1AYLOCh. 21.6 - Prob. 2AYLOCh. 21.6 - Prob. 3AYLOCh. 21.6 - Prob. 4AYLOCh. 21.6 - The pathology of acquired immunodeficiency...Ch. 21 - The only lymphatic organ with both afferent and...Ch. 21 - Prob. 2TYRCh. 21 - Prob. 3TYRCh. 21 - Which of these is a macrophage? a. a microglial...Ch. 21 - Prob. 5TYRCh. 21 - Prob. 6TYRCh. 21 - Which of the following correctly stales the order...Ch. 21 - Prob. 8TYRCh. 21 - Prob. 9TYRCh. 21 - Which of the following results from a lack of...Ch. 21 - Any microorganism capable of causing disease is...Ch. 21 - Prob. 12TYRCh. 21 - Prob. 13TYRCh. 21 - Prob. 14TYRCh. 21 - Prob. 15TYRCh. 21 - Prob. 16TYRCh. 21 - Prob. 17TYRCh. 21 - Prob. 18TYRCh. 21 - Prob. 19TYRCh. 21 - Prob. 20TYRCh. 21 - Prob. 1BYMVCh. 21 - crino-Ch. 21 - extra-Ch. 21 - Prob. 4BYMVCh. 21 - Prob. 5BYMVCh. 21 - Prob. 6BYMVCh. 21 - Prob. 7BYMVCh. 21 - Prob. 8BYMVCh. 21 - Prob. 9BYMVCh. 21 - Prob. 10BYMVCh. 21 - Prob. 1WWTSCh. 21 - Prob. 2WWTSCh. 21 - Prob. 3WWTSCh. 21 - Prob. 4WWTSCh. 21 - Prob. 5WWTSCh. 21 - Prob. 6WWTSCh. 21 - Prob. 7WWTSCh. 21 - Prob. 8WWTSCh. 21 - Prob. 9WWTSCh. 21 - B cells that circulate freely in the bloodstream...Ch. 21 - Prob. 1TYCCh. 21 - Prob. 2TYCCh. 21 - A girl with a defective heart receives a new heart...Ch. 21 - A burn research center uses mice for studies of...Ch. 21 - Prob. 5TYC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
Understanding Health Insurance: A Guide to Billin...Health & NutritionISBN:9781337679480Author:GREENPublisher:Cengage
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Understanding Health Insurance: A Guide to Billin...
Health & Nutrition
ISBN:9781337679480
Author:GREEN
Publisher:Cengage
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Immune System and Immune Response Animation; Author: Medical Sciences Animations;https://www.youtube.com/watch?v=JDdbUBXPKc4;License: Standard YouTube License, CC-BY
Immune response: summary; Author: Dr Bhavsar Biology;https://www.youtube.com/watch?v=ADANgHkX4OY;License: Standard Youtube License