Anatomy & Physiology: The Unity of Form and Function
9th Edition
ISBN: 9781260791563
Author: Kenneth S. Saladin
Publisher: Mcgraw-hill Higher Education (us)
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 21.1, Problem 10AYLO
Summary Introduction
To discuss:
How lymphatic organs differ from diffuse lymphatic tissue and lymphatic nodules; the two primary lymphatic organs and three secondary lymphatic organs, and why they are called this.
Introduction:
The lymphatic system consists of a group of cells or immune cells that inhabit in all the organs of the body. The lymphatic system includes lymphatic organs and group of lymphatic tissues involved in the immune system. The lymphatic organs include spleen, tonsils, thymus, lymph nodes, and bone marrow.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
Chapter 21 Solutions
Anatomy & Physiology: The Unity of Form and Function
Ch. 21.1 - Prob. 1BYGOCh. 21.1 - Prob. 2BYGOCh. 21.1 - Prob. 3BYGOCh. 21.1 - Prob. 4BYGOCh. 21.1 - Prob. 5BYGOCh. 21.1 - Prob. 1AYLOCh. 21.1 - Prob. 2AYLOCh. 21.1 - Prob. 3AYLOCh. 21.1 - Prob. 4AYLOCh. 21.1 - Prob. 5AYLO
Ch. 21.1 - Prob. 6AYLOCh. 21.1 - Prob. 7AYLOCh. 21.1 - The nature of diffuse lymphatic tissue and where...Ch. 21.1 - Prob. 9AYLOCh. 21.1 - Prob. 10AYLOCh. 21.1 - Prob. 11AYLOCh. 21.1 - Prob. 12AYLOCh. 21.1 - Prob. 13AYLOCh. 21.1 - Prob. 14AYLOCh. 21.1 - Location, gross anatomy, and histology of the...Ch. 21.2 - Prob. 6BYGOCh. 21.2 - Prob. 7BYGOCh. 21.2 - How do interferons and the complement system...Ch. 21.2 - Prob. 9BYGOCh. 21.2 - List the cardinal signs of inflammation and state...Ch. 21.2 - Prob. 1AYLOCh. 21.2 - Prob. 2AYLOCh. 21.2 - Differences between innate and adaptive immunity;...Ch. 21.2 - Prob. 4AYLOCh. 21.2 - Prob. 5AYLOCh. 21.2 - Prob. 6AYLOCh. 21.2 - The one type of lymphocyte that is involved in...Ch. 21.2 - Types of macrophages; their origin and functionsCh. 21.2 - Prob. 9AYLOCh. 21.2 - Prob. 10AYLOCh. 21.2 - Prob. 11AYLOCh. 21.2 - Prob. 12AYLOCh. 21.2 - Prob. 13AYLOCh. 21.2 - Prob. 14AYLOCh. 21.2 - Prob. 15AYLOCh. 21.2 - Prob. 16AYLOCh. 21.2 - Examples of inflammatory cytokines and their rolesCh. 21.2 - How hyperemia, bradykinin, and other factors...Ch. 21.2 - Prob. 19AYLOCh. 21.2 - Prob. 20AYLOCh. 21.2 - Prob. 21AYLOCh. 21.3 - Prob. 11BYGOCh. 21.3 - Prob. 12BYGOCh. 21.3 - Contrast active and passive immunity. Give natural...Ch. 21.3 - Prob. 14BYGOCh. 21.3 - Prob. 15BYGOCh. 21.3 - Prob. 16BYGOCh. 21.3 - Prob. 17BYGOCh. 21.3 - Prob. 18BYGOCh. 21.3 - Prob. 1AYLOCh. 21.3 - Prob. 2AYLOCh. 21.3 - How adaptive immunity is classified as active or...Ch. 21.3 - Prob. 4AYLOCh. 21.3 - Prob. 5AYLOCh. 21.3 - Prob. 6AYLOCh. 21.3 - Prob. 7AYLOCh. 21.3 - Prob. 8AYLOCh. 21.3 - Prob. 9AYLOCh. 21.3 - Prob. 10AYLOCh. 21.3 - The meanings of immunocompetence and...Ch. 21.3 - Prob. 12AYLOCh. 21.3 - Prob. 13AYLOCh. 21.3 - Prob. 14AYLOCh. 21.4 - Prob. 19BYGOCh. 21.4 - Prob. 20BYGOCh. 21.4 - Prob. 21BYGOCh. 21.4 - Prob. 22BYGOCh. 21.4 - Prob. 1AYLOCh. 21.4 - Prob. 2AYLOCh. 21.4 - Prob. 3AYLOCh. 21.4 - Prob. 4AYLOCh. 21.4 - Prob. 5AYLOCh. 21.4 - How activated Tc cells destroy target cells; the...Ch. 21.4 - Prob. 7AYLOCh. 21.5 - Prob. 23BYGOCh. 21.5 - Prob. 24BYGOCh. 21.5 - Prob. 25BYGOCh. 21.5 - Similarities and differences between humoral and...Ch. 21.5 - Prob. 2AYLOCh. 21.5 - Prob. 3AYLOCh. 21.5 - Prob. 4AYLOCh. 21.5 - Prob. 5AYLOCh. 21.6 - Prob. 26BYGOCh. 21.6 - Prob. 27BYGOCh. 21.6 - Prob. 28BYGOCh. 21.6 - Prob. 29BYGOCh. 21.6 - Prob. 30BYGOCh. 21.6 - Prob. 1AYLOCh. 21.6 - Prob. 2AYLOCh. 21.6 - Prob. 3AYLOCh. 21.6 - Prob. 4AYLOCh. 21.6 - The pathology of acquired immunodeficiency...Ch. 21 - The only lymphatic organ with both afferent and...Ch. 21 - Prob. 2TYRCh. 21 - Prob. 3TYRCh. 21 - Which of these is a macrophage? a. a microglial...Ch. 21 - Prob. 5TYRCh. 21 - Prob. 6TYRCh. 21 - Which of the following correctly stales the order...Ch. 21 - Prob. 8TYRCh. 21 - Prob. 9TYRCh. 21 - Which of the following results from a lack of...Ch. 21 - Any microorganism capable of causing disease is...Ch. 21 - Prob. 12TYRCh. 21 - Prob. 13TYRCh. 21 - Prob. 14TYRCh. 21 - Prob. 15TYRCh. 21 - Prob. 16TYRCh. 21 - Prob. 17TYRCh. 21 - Prob. 18TYRCh. 21 - Prob. 19TYRCh. 21 - Prob. 20TYRCh. 21 - Prob. 1BYMVCh. 21 - crino-Ch. 21 - extra-Ch. 21 - Prob. 4BYMVCh. 21 - Prob. 5BYMVCh. 21 - Prob. 6BYMVCh. 21 - Prob. 7BYMVCh. 21 - Prob. 8BYMVCh. 21 - Prob. 9BYMVCh. 21 - Prob. 10BYMVCh. 21 - Prob. 1WWTSCh. 21 - Prob. 2WWTSCh. 21 - Prob. 3WWTSCh. 21 - Prob. 4WWTSCh. 21 - Prob. 5WWTSCh. 21 - Prob. 6WWTSCh. 21 - Prob. 7WWTSCh. 21 - Prob. 8WWTSCh. 21 - Prob. 9WWTSCh. 21 - B cells that circulate freely in the bloodstream...Ch. 21 - Prob. 1TYCCh. 21 - Prob. 2TYCCh. 21 - A girl with a defective heart receives a new heart...Ch. 21 - A burn research center uses mice for studies of...Ch. 21 - Prob. 5TYC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Understanding Health Insurance: A Guide to Billin...Health & NutritionISBN:9781337679480Author:GREENPublisher:Cengage
Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
Understanding Health Insurance: A Guide to Billin...
Health & Nutrition
ISBN:9781337679480
Author:GREEN
Publisher:Cengage
Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning