Study Guide for Campbell Biology
11th Edition
ISBN: 9780134443775
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Jane B. Reece, Martha R. Taylor, Michael A. Pollock
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 21, Problem 4IQ
Explain why retrotransposons always move by the “copy-and-paste” mechanism.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Could a single nucleotide deletion restore the function of a protein-coding gene interrupted by the insertion of a 4-nt sequence? Explain.
In reverse transcriptase polymerase chain reaction (RT-PCR), an analytical method used to amplify RNA from trace amounts of a template, a temperature program is used to correspond to the denaturation and annealing of the nucleic acids being amplified. It starts with a gradual and constant increase from room temperature to the starting temperature for each cycle. What kind of function describes this gradual increase?
The following DNA nucleotides are found near the end of a bacterial transcription unit.
3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′
Q. Is this terminator rho independent or rho dependent?
Chapter 21 Solutions
Study Guide for Campbell Biology
Ch. 21 - In what ways would third-generation sequencing be...Ch. 21 - Prob. 2IQCh. 21 - Refer to the organisms listed in Table 21.1 in...Ch. 21 - Explain why retrotransposons always move by the...Ch. 21 - For each of the following types of DNA sequences...Ch. 21 - Prob. 6IQCh. 21 - Prob. 7IQCh. 21 - If all Hox genes contain the same or very similar...Ch. 21 - About 25% of the human genome relates to the...Ch. 21 - Prob. 2SYK
Ch. 21 - Which of the following has decreased the time and...Ch. 21 - Prob. 2TYKCh. 21 - In the process called gene annotation, computer...Ch. 21 - Prob. 4TYKCh. 21 - Prob. 5TYKCh. 21 - Prob. 6TYKCh. 21 - What is a pseudogene? a. a gene that has been...Ch. 21 - Prob. 8TYKCh. 21 - Which of the following is common to both...Ch. 21 - Prob. 10TYKCh. 21 - Prob. 11TYKCh. 21 - Prob. 12TYKCh. 21 - Prob. 13TYKCh. 21 - Prob. 14TYKCh. 21 - Compared to genes in mice and chimpanzees, most...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Why are mutants used as test organisms in the Ames test?
Laboratory Experiments in Microbiology (12th Edition) (What's New in Microbiology)
Some people compare DNA to a blueprint stored in the office of a construction company. Explain how this analogy...
Biology: Concepts and Investigations
WHAT IF? As a cell begins the process of dividing, its chromosomes become shorter, thicker, and individually vi...
Campbell Biology in Focus (2nd Edition)
More than one choice may apply. Using the terms listed below, fill in the blank with the proper term. anterior ...
Essentials of Human Anatomy & Physiology (11th Edition)
Why are mutants used as test organisms in the Ames test?
Laboratory Experiments in Microbiology (11th Edition)
Match the people in column A to their contribution toward the advancement of microbiology, in column B. Column ...
Microbiology: An Introduction (13th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Why would a mutation in a somatic cell of a multicellular organism escape detection?arrow_forwardGiven this sequence: AUG TAT ACC GAG, which of the following would result in a frameshift mutation? AUG ACC GAG AUG TAA CCG AG AUG AAA ACC GAG O AGG TAT ACC GAGarrow_forwardWhich of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′arrow_forward
- DNA supercoiling, which occurs when coiling tension is generated ahead of the replication fork, is relieved by DNA gyrase. Supercoiling may also be involved in transcription regulation. Researchers discovered that enhancers operating over a long distance (2500 bp) are dependent on DNA supercoiling, while enhancers operating over shorter distances (110 bp) are not so dependent [Liu et al. (2001). Proc. Natl. Acad. Sci. USA 98:14,883–14,888]. Using a diagram, suggest a way in which supercoiling may positively influence enhancer activity over long distances.arrow_forwardWhen the cDNA was sequenced by the Sanger method utilizing ddCTP, the following products were obtained: Tetranucleotide Hexanucleotide Nonanucleotide Decanucleotide Dodenucleotide Octadecanucleotide Nonadecanucleotide 21-nucleotide 6c. What is the sequence of the bases in the mRNA coding for the peptide above? Thearrow_forwardSome organisms have mechanisms in place that will override transcription termination. One such mechanism using the Tat protein is employed by the HIV retrovirus. Explain why Tat is therefore a good target for HIV vaccination.arrow_forward
- Define origin-recognition complex (ORC)arrow_forwardThe initiation phase of eukaryotic transcription via RNA polymerase II is considered an assembly and disassembly process. Which types of biochemical interactions—hydrogen bonding, ionic bonding, covalent bonding, and/or hydrophobic interactions—would you expect to drive the assembly and disassembly process? How would temperature and salt concentration affect assembly and disassembly?arrow_forwardWhy can it be said that transcription of thebacteriophage T7 genome requires two enzymes?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License