Study Guide for Campbell Biology
11th Edition
ISBN: 9780134443775
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Jane B. Reece, Martha R. Taylor, Michael A. Pollock
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 21, Problem 5IQ
For each of the following types of DNA sequences found in the human genome, write the letter of the correct description and the percentage of the genome (listed beneath the descriptions) in the blanks provided.
Descriptions
- A. DNA in centromeres and telomeres, also STRs
- B. multiple copies of mostly movable sequences
- C. gene fragments and pseudogenes
- D. protein-and RNA-coding sequences
- E. family of short sequences related to transposable elements
- F. multiple copies of large sequences
- G. longer retrotransposons with low rate of transposition
- H. enhancers, promoters, and other such sequences
- I. noncoding sequences within genes
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Complete each of the following statements by selecting from the bank of terms below.
a. tRNA
b. spontaneous
c. repressible
d. RNA processing
e. mutagen
f. SNRNA
g. redundancy
h. universal
i. promoter
j. elongation
There are several three nucleotide codons that code for the same amino acid. This is known as (81).
A specific three nucleotide codon for a fruit fly codes for the same amino acid as that same specific
three nucleotide codon for a human. This means that the genetic code is (82).
The three steps of transcription are initiation, (83), and termination.
The (84) region on a chromosome is the sequence of nucleotides in DNA that indicates where the RNA
polymerase complex should bind to initiate transcription.
In a eukaryotic cell mRNA is modified in three ways. This is known as (85).
The role of (86) is to combine with protein and then bind to introns to remove them and splice the RNA
together.
The role of (87) is to transport amino acids to the ribosome where the anticodon loop…
Your advisor, a brilliant bioinformatician, has high regard for your intellect and industry. she suggests that you write a computer program that will identify the exons of protein- coding genes directly from the sequence of the human genome. In preparation for that task, you decide to write down a list of the features that might distinguish protein- coding sequences from intronic DNA and from other sequences in the genome. What features would you list?
Define the following terms: a. DNA typing b. short tandem repeats c. DNA profile d. nucleosome e. retrotransposon
Chapter 21 Solutions
Study Guide for Campbell Biology
Ch. 21 - In what ways would third-generation sequencing be...Ch. 21 - Prob. 2IQCh. 21 - Refer to the organisms listed in Table 21.1 in...Ch. 21 - Explain why retrotransposons always move by the...Ch. 21 - For each of the following types of DNA sequences...Ch. 21 - Prob. 6IQCh. 21 - Prob. 7IQCh. 21 - If all Hox genes contain the same or very similar...Ch. 21 - About 25% of the human genome relates to the...Ch. 21 - Prob. 2SYK
Ch. 21 - Which of the following has decreased the time and...Ch. 21 - Prob. 2TYKCh. 21 - In the process called gene annotation, computer...Ch. 21 - Prob. 4TYKCh. 21 - Prob. 5TYKCh. 21 - Prob. 6TYKCh. 21 - What is a pseudogene? a. a gene that has been...Ch. 21 - Prob. 8TYKCh. 21 - Which of the following is common to both...Ch. 21 - Prob. 10TYKCh. 21 - Prob. 11TYKCh. 21 - Prob. 12TYKCh. 21 - Prob. 13TYKCh. 21 - Prob. 14TYKCh. 21 - Compared to genes in mice and chimpanzees, most...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A molecular geneticist hopes to find a gene gene in human liver cells that codes for an important blood clotting protein. He knows that the nucleotides sequence of a small part of the gene is GTGGACTGACA. briefly explain how to obtain the desired genearrow_forwardIdentify the word or phrase that is the best match (some will remain blank). (Mouse Genome Informatics, GeneChip array, Confounding variable, 45,000, BLAST, 600, Aceview, BioGPS, SMART, minimize, 17, UCSC Genome Browser, External validity) A. Median number of copies of an mRNA in a cell B. Patterns and sizes of introns and exons C. H3K4me3 locations on chromosomes D. Each treatment given to a different litter of mice E. Find list of knockout mice for a gene D. Find similar proteins F. Random variation G. Tissue expression pattern of a gene H. The extent to which results can be extrapolatedarrow_forwardConsider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?arrow_forward
- Parts a-earrow_forwardYou have sequenced the genome of the bacterium Salmonella typhimurium, and you are using BLAST analysis to identify similarities within the S. typhimurium genome to known proteins. You find a protein that is 100 percent identical in the bacterium Escherichia coli. When you compare nucleotide sequences of the S. typhimurium and E. coli genes, you find that their nucleotide sequences are only 87 percent identical.a. Explain this observation.b. What do these observations tell you about the merits of nucleotide- versus protein-similarity searches in identifying related genes?arrow_forwardThe human genome contains thousands of sequences known as small open reading frames, some of which encode proteins of about 30 amino acids. What is the minimum number of nucleotides required to encode such a protein?arrow_forward
- To test whether you understand the processes involved in the Central Dogma of Molecular Genetics, determine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. Partner DNA strands the mRNA strands the tRNA the formed amino acids the discussion of the entire procedurearrow_forwardThe following figure shows a screen shot from the UCSC Genome Browser, focusing on a region of the human genome encoding a gene called MFAP3L. (Note hg38 refers to version 38 of the human genome RefSeq)a. Describe in approximate terms the genomic location of MFAP3L.b. Is the gene transcribed in the direction from the centromere-to-telomere or from the telomere-to-centromere?c. How many alternative splice forms of MFAP3L mRNA are indicated by the data?d. How many different promoters for MFAP3L are suggested by the data?arrow_forwardThe following figure shows a screen shot from the UCSC Genome Browser, focusing on a region of the human genome encoding a gene called MFAP3L. (Note hg38 refers to version 38 of the human genome RefSeq)a. Describe in approximate terms the genomic location of MFAP3L.b. Is the gene transcribed in the direction from the centromere-to-telomere or from the telomere-to-centromere?c. How many alternative splice forms of MFAP3L mRNA are indicated by the data?d. How many different promoters for MFAP3L are suggested by the data? (please do not copy and paste the answer from below. i don't think it is correct. a. MFAP3L is mostly found in the nucleus in the genome. It is found on chromosome 4 reverse strand. The protein produced by the gene is found in the cell membrane, and it is positioned on the membrane with the carboxyl side of the protein facing the cytosol. b. The MFAP3L gene is transcribed from the telomere to the centromere. c. According to the data, there are 11 different splice forms…arrow_forward
- The following figure shows a screen shot from the UCSC Genome Browser, focusing on a region of the human genome encoding a gene called MFAP3L. (Note hg38 refers to version 38 of the human genome RefSeq) a. Describe in approximate terms the genomic location of MFAP3L. b. Is the gene transcribed in the direction from the centromere-to-telomere or from the telomere-to-centromere? c. How many alternative splice forms of MFAP3L mRNA are indicated by the data? d. How many different promoters for MFAP3L are suggested by the data?arrow_forwardIn your own wordsarrow_forwardConsider the following gene with their respective introns and exons 5’ – TCATGCATTTTGCGCGGGAAATAGCTCA – 3’ 3’ – AGTACGTAAAACGCGCCCTTTATCGAGT – 5’ Using the bottom as a template strand, create: A. A primary mRNA transcript B. A processed mRNA transcriptC. Highlight where your START and STOP codons are in your processed transcript (if there are any). D. The resulting protein sequencearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License