Study Guide for Campbell Biology
11th Edition
ISBN: 9780134443775
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Jane B. Reece, Martha R. Taylor, Michael A. Pollock
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 21, Problem 1SYK
About 25% of the human genome relates to the production of proteins or RNA products (exons, introns, or regulatory sequences). Is the remaining 75% just “junk”? Describe the following types of noncoding DNA, including some of their possible functions.
a. transposable elements
b. Alu elements
c. L1 sequences
d. simple sequence DNA
e. pseudogenes
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
One of the following is a characteristic of eukaryotic genetic material?
1. Eukaryotic genetic material is compacted by wrapping the double-helix around histone proteins to form nucleosomes.
2. Eukaryotic genetic material consists of supercoiled circular DNA molecules complexed with proteins into chromosomes.
3. Eukaryotic genetic material consists of relaxed linear DNA molecules complexed with RNA into a 30 nm fiber.
4. Eukaryotic genetic material is compacted by folding linker regions around non-histone proteins to form a scaffold.
Define the following terms: a. histone b. heterochromatin c. spermine d. intergenic sequences e. tandem repeats
A molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting protein. He knows that the nucleotide sequence of a small part of the gene is GTGGAСTGACA. Briefly explain how to obtain the desired gene.
Chapter 21 Solutions
Study Guide for Campbell Biology
Ch. 21 - In what ways would third-generation sequencing be...Ch. 21 - Prob. 2IQCh. 21 - Refer to the organisms listed in Table 21.1 in...Ch. 21 - Explain why retrotransposons always move by the...Ch. 21 - For each of the following types of DNA sequences...Ch. 21 - Prob. 6IQCh. 21 - Prob. 7IQCh. 21 - If all Hox genes contain the same or very similar...Ch. 21 - About 25% of the human genome relates to the...Ch. 21 - Prob. 2SYK
Ch. 21 - Which of the following has decreased the time and...Ch. 21 - Prob. 2TYKCh. 21 - In the process called gene annotation, computer...Ch. 21 - Prob. 4TYKCh. 21 - Prob. 5TYKCh. 21 - Prob. 6TYKCh. 21 - What is a pseudogene? a. a gene that has been...Ch. 21 - Prob. 8TYKCh. 21 - Which of the following is common to both...Ch. 21 - Prob. 10TYKCh. 21 - Prob. 11TYKCh. 21 - Prob. 12TYKCh. 21 - Prob. 13TYKCh. 21 - Prob. 14TYKCh. 21 - Compared to genes in mice and chimpanzees, most...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Why is it necessary to be in a pressurized cabin when flying at 30,000 feet?
Anatomy & Physiology
2. A gene is a segment of DNA that has the information to produce a functional product. The functional product ...
Genetics: Analysis and Principles
Why are mutants used as test organisms in the Ames test?
Laboratory Experiments in Microbiology (11th Edition)
Relative thickness of the myocardium in different chambers; the functional significance of those differences; a...
Anatomy & Physiology: The Unity of Form and Function
Gregor Mendel never saw a gene, yet he concluded that some inherited factors were responsible for the patterns ...
Campbell Essential Biology (6th Edition) - standalone book
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The image below shows the base cytosine and a methylated form of cytosine that occurs frequently in the human genome. Use your knowledge of DNA structure to answer the following questions: a) Does methylation of cytosine affect its ability to base-pair with guanine? Explain your answer. b) Would methylation of cytosine affect the binding of a protein that interacts with a C-G base-pair in the major groove?arrow_forwardAs you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________arrow_forwardTo test whether you understand the processes involved in the Central Dogma of Molecular Genetics, determine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. Partner DNA strands the mRNA strands the tRNA the formed amino acids the discussion of the entire procedurearrow_forward
- The image below shows the base cytosine and a methylated form of cytosine that occurs frequently in the human genome. Use your knowledge of DNA structure to answer the following question: a) Does methylation of cytosine affect its ability to base-pair with guanine? Explain b) Could methylation of cytosine affect the binding of a protein that interacts with a C-G base-pair in the major groove? Explain your answer.arrow_forwardOn the basis of current knowledge, the protein-encoding regions account for only about 3% of the human genome. What is the function of the rest of the DNA?arrow_forwardDefine the following terms: a. DNA typing b. short tandem repeats c. DNA profile d. nucleosome e. retrotransposonarrow_forward
- Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?arrow_forwardIf the following nucleotide sequence, CTC/TGT/AAG/ACC/TTT experienced a mutation resulting in the deletion of the second cytosine in the first DNA triplet so the sequence is now CT_/TGT/AAG/ACC/TTT, what would be the amino acid sequence created from this mutated DNA strand? Table of mRNA codons UUA, UUG = leucine AGG, AGA = arginine %3D CAU, CAC = histidine GUU, GÜC, GUA = valine GAA. GAG=glutamic acid GCU, GUA, GUG = alanine GAU, GAC = asparagine GGU, GGC, GGA = glycine UCA, UCU =serine CGU, CGC, CGA = argininearrow_forwardA molecular geneticist hopes to find a Gene in human liver cell that codes for an important blood-clotting protein,he knows that the nucleotide sequence of a small part of the Gene is GTGGACTGACA.briefly explain how to obtain genearrow_forward
- Parts a-earrow_forwardWhich of the followings statements are true about DNA polymerase? 1.) It can only go in one direction, meaning the lagging strand can't be synthesized continuously. 2.) It cannot start a DNA strand from scratch, so another enzyme is needed to create "primers" as a starting point. 3.) It cannot copy epigenetic marks (such as methyl groups) on its own; these must be "copied" onto the daughter DNA strand by other enzymes after DNA replication. 4.) All of the abovearrow_forwardCystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which prevent ions from moving across cell membranes. Normally there are channel proteins that allow passage of the ions, but in patients with one kind of CF these proteins seem odd. Closer examination shows that these proteins display the correct amino acid sequence. However, they fail to do their job. A) Given that the primary structure of the protein is correct, what can you infer about the DNA sequence for the gene coding this protein on this patient, is there a mutation? Explain. B) Why is the primary structure insufficient to guarantee the proper function of the protein?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License