Biochemistry
9th Edition
ISBN: 9781305961135
Author: Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 20, Problem 42RE
Interpretation Introduction
Interpretation:
The statement “Dinitrophenol was once used as a diet drug” is to be explained.
Concept introduction:
Chemiosmotic coupling mechanism couples or links the flow of electrons.
The uncouplers in mitochondria play a vital role as dinitrophenol acts as an uncoupler and follows the reactivity property of uncouplers.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Chapter 20 Solutions
Biochemistry
Ch. 20 - RECALL Briefly summarize the steps in the electron...Ch. 20 - RECALL Are electron transport and oxidative...Ch. 20 - Prob. 3RECh. 20 - REFLECT AND APPLY Show how the reactions of the...Ch. 20 - REFLECT AND APPLY How does mitochondrial structure...Ch. 20 - Prob. 6RECh. 20 - Prob. 7RECh. 20 - MATHEMATICAL Using the information in Table 20.2,...Ch. 20 - Prob. 9RECh. 20 - Prob. 10RE
Ch. 20 - MATHEMATICAL Calculate E for the following...Ch. 20 - Prob. 12RECh. 20 - MATHEMATICAL Which is more favorable...Ch. 20 - REFLECT AND APPLY Comment on the fact that the...Ch. 20 - RECALL What do cytochromes have in common with...Ch. 20 - RECALL How do the cytochromes differ from...Ch. 20 - RECALL Which of the following does not play a role...Ch. 20 - Prob. 18RECh. 20 - Prob. 19RECh. 20 - REFLECT AND APPLY Two biochemistry students are...Ch. 20 - REFLECT AND APPLY Cytochrome oxidase and...Ch. 20 - Prob. 22RECh. 20 - REFLECT AND APPLY Reflect on the evolutionary...Ch. 20 - REFLECT AND APPLY Experimental evidence strongly...Ch. 20 - Prob. 25RECh. 20 - REFLECT AND APPLY What is the advantage of having...Ch. 20 - REFLECT AND APPLY Why do the electron-transfer...Ch. 20 - Prob. 28RECh. 20 - Prob. 29RECh. 20 - Prob. 30RECh. 20 - RECALL Describe the role of the F1 portion of ATP...Ch. 20 - Prob. 32RECh. 20 - Prob. 33RECh. 20 - Prob. 34RECh. 20 - REFLECT AND APPLY What is the approximate P/O...Ch. 20 - REFLECT AND APPLY Why is it difficult to determine...Ch. 20 - REFLECT AND APPLY What are some of the...Ch. 20 - RECALL Briefly summarize the main arguments of the...Ch. 20 - Prob. 39RECh. 20 - Prob. 40RECh. 20 - Prob. 41RECh. 20 - Prob. 42RECh. 20 - REFLECT AND APPLY Criticize the following...Ch. 20 - Prob. 44RECh. 20 - Prob. 45RECh. 20 - Prob. 46RECh. 20 - RECALL How does the yield of ATP from complete...Ch. 20 - REFLECT AND APPLY The malate-aspartate shuttle...Ch. 20 - MATHEMATICAL What yield of ATP can be expected...Ch. 20 - MATHEMATICAL The free-energy change (G) for the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- REFLECT AND APPLY In Section 2-4, we said that at the equivalence point of a titration of acetic acid, essentially all the acid has been converted to acetate ion. Why do we not say that all the acetic acid has been converted to acetate ion?arrow_forwardREFLECT AND APPLY Why are proteins more effective catalysts than RNA molecules?arrow_forwardREFLECT AND APPLY Chemotherapy patients receiving cytotoxic (cell-killing) agents such as FdUMP (the UMP analogue that contains fluorouracil) and methotrexate temporarily go bald. Why does this take place?arrow_forward
- BIOCHEMICAL CONNECTIONS Beriberi is a disease caused by a deficiency of vitamin B1 (thiamine) in the diet. Thiamine is the precursor of thiamine pyrophosphate. In view of what you have learned in this chapter, why is it not surprising that alcoholics tend to develop this disease?arrow_forwardBIOCHEMICAL CONNECTIONS You have been hired by a pharmaceutical company to work on development of drugs to treat AIDS. What information from this chapter will be useful to you?arrow_forwardREFLECT AND APPLY Explain the function of histidine 57 in the mechanism of chymotrypsin.arrow_forward
- REFLECT AND APPLY Sulfanilamide and related sulfa drugs were widely used to treat diseases of bacterial origin before penicillin and more advanced drugs were readily available. The inhibitory effect of sulfanilamide on bacterial growth can be reversed by p-aminobenzoate. Suggest a mode of action for sulfanilamide.arrow_forwardRECALL Discuss the role of feedback inhibition in the anabolism of purine-containing nucleotides.arrow_forwardREFLECT AND APPLY Why is it necessary or advantageous for the body to make zymogens?arrow_forward
- REFLECT AND APPLY Why are thioesters considered high-energy compounds?arrow_forwardREFLECT AND APPLY Is it good (or bad) that enzymes can be reversibly inhibited? Why?arrow_forwardREFLECT AND APPLY Each of the following pairs of primers has a problem with it. Tell why the primers would not work well. (a) Forward primer 5'GCCTCCGGAGACCCATTGG3' Reverse primer 5'TTCTAAGAAACTGTTAAGG3' (b) Forward primer 5'GGGGCCCCTCACTCGGGGCCCC3' Reverse primer 5'TCGGCGGCCGTGGCCGAGGCAG3' (c) Forward primer 5'TCGAATTGCCAATGAAGGTCCG3' Reverse primer 5'CGGACCTTCATTGGCAATTCGA3'arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY