PRESCOTT'S MICROBIOLOGY
11th Edition
ISBN: 2818440045677
Author: WILLEY
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 19.3, Problem 2CC
Why is rRNA so suitable for determining relatedness?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Why must tRNA molecules have both unique structural features and common structural features?
What is meant by the statement “The genetic code is universal”? What is the significance of this finding?
Which part of a cell is the tRNA produced?
Chapter 19 Solutions
PRESCOTT'S MICROBIOLOGY
Ch. 19.1 - What is a natural classification? What microbial...Ch. 19.1 - Prob. 2CCCh. 19.1 - Consider the finding that bacteria capable of...Ch. 19.2 - What is the difference between a microbial species...Ch. 19.2 - Why is it important to have a type strain for each...Ch. 19.2 - The genus Salmonella was once thought to contain...Ch. 19.3 - What are the advantages of using each major group...Ch. 19.3 - Why is rRNA so suitable for determining...Ch. 19.3 - Prob. 3CCCh. 19.4 - Could a phylotype be considered an OTU? What about...
Ch. 19.4 - List the differences between distance-based and...Ch. 19.4 - Prob. 3CCCh. 19.4 - You are building a tree based on 16S rRNA sequence...Ch. 19.4 - Is HGT involved in movement of genes in the core...Ch. 19.5 - On what evidence is this hypothesis based?Ch. 19.5 - Construct a scenario in which each of the...Ch. 19.5 - Define ecotype. Do you think it is necessary to...Ch. 19.5 - What is the difference between the core genome and...Ch. 19.5 - Of the following genes, which do you think are...Ch. 19.5 - Prob. 4CCCh. 19.6 - Prob. 1CCCh. 19.6 - Describe two different situations in which it...Ch. 19 - Prob. 1RCCh. 19 - Prob. 2RCCh. 19 - Prob. 3RCCh. 19 - Prob. 4RCCh. 19 - Prob. 5RCCh. 19 - Prob. 6RCCh. 19 - Consider the fact that the use of 16S rRNA...Ch. 19 - You have recently established a pure culture of a...Ch. 19 - Prob. 3ALCh. 19 - Prob. 4ALCh. 19 - Prob. 5ALCh. 19 - Prob. 6ALCh. 19 - Prob. 7AL
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- How does the cell ensure that a specific amino acid (say, valine) attaches itself only to the one tRNA molecule that is specific for valine? (A) Proteins called aminoacyl DNA synthetases are responsible for bringing together the proper pair. The enzymes match the amino acid and one of the correct DNA molecules carrying the right anticodon. (B) Lipids called aminoacyl tRNA synthetases are responsible for bringing together the proper pair. The lipid binds the amino acid and one of the correct tRNA molecules carrying the right codon. (C) Enzymes called aminoacyl tRNA synthetases are responsible for bringing together the proper pair. The enzymes match the amino acid and one of the correct tRNA molecules carrying the right anticodon. (D) Enzymes called peptidyl mRNA synthetases are responsible for bringing together the proper pair. The enzymes match the amino acid and one of the correct mRNA molecules carrying the right anticodon.arrow_forwardIf an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it have on the amino acid sequence of the globin polypeptides? Will the globin most likely be fully functional, partly functional, or nonfunctional? Why?arrow_forwardHow many kilobases of the DNA strand below will code for the protein product?arrow_forward
- What amino acid would a tRNA with anticodon CUA carry? Enter the 3 letter code only [A]. [e.g. Met for anticodon UAC]arrow_forwardAn RNA molecule has the following percentages of bases: A = 27%, U = 38%, C=20%, G = 15%. (A) Is this RNA molecule single-stranded or double stranded? How can you tell? (B) What would be the percentage of each of the bases in the template strand of the DNA that contains the gene for this RNA?arrow_forwardIn what ways does the double helix explain the essential properties of a gene?arrow_forward
- Is there any function for an intron?arrow_forwardIf a bacterial protein is 3,300 amino acids long, how many nucleotidepairs long is the gene sequence that codes for it?arrow_forwardAs you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license