Biology
12th Edition
ISBN: 9781260494570
Author: Raven, Peter
Publisher: MCGRAW-HILL HIGHER EDUCATION
expand_more
expand_more
format_list_bulleted
Question
Chapter 18, Problem 7U
Summary Introduction
Introduction:
The term proteome is coined by Marc Wilkins in 1994. This term is applied to many different types of systems in biology such as cellular proteome, complete proteome and so on. In eukaryotes, proteome can be greater than genome.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Why can the transcriptome not be used to predict the proteome with complete accuracy?
a. It cannot be sequenced like the genome can be.
b. The transcriptome is too dynamic to be used to make predictions.
c. Not all genes are transcribed.
d. Many transcripts are alternatively spliced to produce different proteins.
How is translation different in prokaryotes and eukaryotes?
a. In prokaryotes, because they do not have a nucleus, the translation of mRNA occurs while it is being transcribed b. In prokaryotes, pre-mRNA translation before transcription occurs within the cell
c.In prokaryotes, reverse trancriptase simultaneously translates and transcribes mRNAd.In prokaryotes, functional mRNA allows for translation to be skipped, and proteins are made during transcription
The CFTR membrane protein has an alpha helix that spans the membrane. The amino acid sequence of the central portion of this alpha helix, which is embedded within the membrane, is which one of the sequences below? Sequences are provided in the single letter code.
a.
VVVEVVVVEVVEEEVE
b.
VVVLVVVVLVVLLLVL
c.
VVVLVVVVREERRRER
d.
EEEREEEEREERRRER
Chapter 18 Solutions
Biology
Ch. 18.1 - Prob. 1LOCh. 18.1 - Describe the pros and cons of restriction mapping,...Ch. 18.1 - Prob. 3LOCh. 18.2 - Discriminate between dideoxy terminator sequencing...Ch. 18.2 - Prob. 2LOCh. 18.3 - Describe the findings of the Human Genome Project.Ch. 18.3 - Prob. 2LOCh. 18.3 - Prob. 3LOCh. 18.4 - Prob. 1LOCh. 18.4 - Prob. 2LO
Ch. 18.4 - Prob. 3LOCh. 18.5 - Prob. 1LOCh. 18.5 - Prob. 2LOCh. 18.5 - Prob. 3LOCh. 18.6 - Prob. 1LOCh. 18 - Prob. 1DACh. 18 - If the human genome contains approximately 3...Ch. 18 - Prob. 1IQCh. 18 - Prob. 2IQCh. 18 - Prob. 3IQCh. 18 - Prob. 4IQCh. 18 - Prob. 5IQCh. 18 - Prob. 6IQCh. 18 - A genetic map provides a. the sequence of the DNA...Ch. 18 - Prob. 2UCh. 18 - Approximately how many genes are there in the...Ch. 18 - An open reading frame (ORF) is distinguished by...Ch. 18 - What is a BLAST search? a. A mechanism for...Ch. 18 - Prob. 6UCh. 18 - Prob. 7UCh. 18 - Prob. 8UCh. 18 - Prob. 1ACh. 18 - Prob. 2ACh. 18 - Prob. 3ACh. 18 - Prob. 4ACh. 18 - What information can be obtained from a DNA...Ch. 18 - Prob. 6ACh. 18 - Prob. 7ACh. 18 - You are in the early stages of a genome-sequencing...Ch. 18 - Genomic research can be used to determine if an...
Knowledge Booster
Similar questions
- What is the correct tRNA anti-codon sequence for the AUG mRNA sequences? a. UGA b. UAC c. CAU d. AUGarrow_forwardWhich sequences are spliced out of the mRNA strand before leaving the nucleus? In other words, which sequences are not part of the code for the amino acids? a. exons b. intronsarrow_forwardRefer to the figure to answer these questions:a. Add labels for mRNA (including the 5′ and 3′ ends) and tRNA. Inaddition, draw in the RNA polymerase enzyme and the ribosomes,including arrows indicating the direction of movement for each.b. What are the next three amino acids to be added to polypeptide b?c. Fill in the nucleotides in the mRNA complementary to thetemplate DNA strand.d. What is the sequence of the DNA complementary to the templatestrand (as much as can be determined from the figure)?e. Does this figure show the entire polypeptide that this geneencodes? How can you tell?f. What might happen to polypeptide b after its release from theribosome?g. Does this figure depict a prokaryotic or a eukaryotic cell? How canyou tell?arrow_forward
- What strategy does a genetically encoded calcium indicator look like to allow fluorescence imaging of only one cell type in an acute slice of the brain? A.The use of fluorescent protein expression inhibitors in other cells B.The injection of a recombinant virus causing the death of other cells C.The use of a promoter specific to these cells D.Activation of membrane receptors specific to these cellsarrow_forwardGiven: 3' TAC CAG TTA AGC CTC GGT ATC CAG GAT ACG 5' What would be the first 10 bases at the 5' end of the complementary strand? A. 5' TCG CGTATC C 3' C. 5' GGC TTA ACT G 3' E. none of the choices B. 5' ATG GTC AATT 3' D. 5' CGT ATC CTG G 3' WRITE THE CAPITAL LETTER OF YOUR ANSWER.arrow_forwardUse the pre-mRNA sequence shown below to answer the following questions. MRNA: 5'ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3' a. Underline the 5' and 3' splice sites, then write the sequence of the spliced mRNA in the space provided. b. Predict what would happen if the G in the 5' splice site were mutated to a C. c. We learned in this topic that the 5' cap in an mRNA plays a role in translation initiation. What do you think is one plausible mechanism by which a 5' cap can enhance initiation ? How can you experimentally demonstrate that a 5' cap is important for this process ?arrow_forward
- A promoter is ______. a. a specific sequence of DNA nucleotides b. a specific sequence of RNA nucleotides c. a protein that binds to DNA d. an enzyme that synthesizes RNAarrow_forwardwhat is the first event to take place in translation in eukaryotic cell? a. An clongation of the polypeptide chain by the addition of amino acids b. Binding of the larger ribosomal subunits to the smaller ribosomal subunits c. Base pairing of activated methionine-tRNA to AUG of messenger RNA d. The small subunits of ribosome recognizing and attaching to 5' cap of mRNAarrow_forwardWhy might a single base-pair mutation in eukaryotic mRNA be less serious than one in prokaryotic mRNA? a. If the mutation occurs in the 5' end of the start site, it will not affect the gene product. b. If the mutation occurs in the exon, it will not affect the gene product. c. If the mutation occurs in the splice site of a transcript with alternative splicing, only one gene product may affected. O d. If the mutation occurs in the intron or not in the splice site of a transcript with alternative splicing, it will nc affect the gene product. O e. If the mutation occurs in the 3' end of the start site, it will not affect the gene product. OLIE STIC N 1Aarrow_forward
- Which mode of information transfer in the Centra Dogma does not occur in the real world (which is not physiological)? a. RNA to DNA b. DNA to protein c. RNA to Protein d. DNA to RNAarrow_forwardWhich of the following BEST describes the characteristics and function of siRNA? A. a short strand of RNA that can complement and inactivate a sequence of mRNA B. a short strand of RNA that can act as a transcription factor to initiate transcription C. a strand of DNA that can bind to and inactivate an mRNA sequence D. a tRNA that is not able to attach to a ribosome and therefore inhibits the process of translationarrow_forwardGive typing answer with explanation and conclusionarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College